Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Anopheles gambiae body parts

ABSTRACT: The transcriptional profile of four tissues for the multi insecticide Anopheles gambiae (Tiassale) and lab susceptible Anopheles gambiae strain N'Gousso. The malpighian tubules, abodmen integument (containing the fat body epidermal, neuronal, muscle and oenocyte cells), midgut and remaining structures were dissected and compared two ways: (i) each body part against the corresponding whole organism (ii) resistant against corresponding susceptible body parts.

ORGANISM(S): Anopheles gambiae

SUBMITTER: Victoria Ingham

PROVIDER: E-MTAB-2808 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Tiassale (deltamethrin exposed) compared to N'Gousso

Project description:Resistant Tiassale (Ivory Coast) strain compared to the lab susceptible N'Gousso. Tiassale was exposed to deltamethrin and the survivors were left for 48 hours prior to the array being performed.

2015-02-07 | E-MTAB-3210 | biostudies-arrayexpress

M'Be (deltamethrin exposed) compared to N'Gousso

Project description:Resistant M'Be (Ivory Coast) strain compared to the lab susceptible N'Gousso. M'Be was exposed to deltamethrin and the survivors were left for 48 hours prior to the array being performed.

2015-02-07 | E-MTAB-3211 | biostudies-arrayexpress

Bouake (deltamethrin exposed) compared to N'Gousso

Project description:Resistant Bouake (Ivory Coast) strain compared to the lab susceptible N'Gousso. Bouake was exposed to deltamethrin and the survivors were left for 48 hours prior to the array being performed.

2015-02-07 | E-MTAB-3212 | biostudies-arrayexpress

Comparison of a resistant field Anopheles coluzzii population from Banfora, Burkina Faso to lab susceptible N'Gousso 2014

Project description:Field resistant Anopheles coluzzii were compared to the lab susceptible Anopheles coluzzii N'Gousso. The samples were collected in 2014 in Burkina Faso and show resistance to pyrethroid insecticides.

2018-07-29 | E-MTAB-6498 | biostudies-arrayexpress

Expression data from the mosquito Anopheles gambiae midgut 3h after a protein meal with or without E. coli.

Project description:The Anopheles gambiae midgut harbors bacteria that proliferate upon a blood feed. We used microarrays to examine the midgut gene expression response at early stages (3hours) after an artifitial meal containing heat killed bacteria. Anopheles gambiae G3 mosquitoes 5-6 day-old were fed BSA (20% in PBS with fresh 10 mM sodium bicarbonate) with or without heat killed E. coli (equivalent of 2.5 ml of 0.8 OD) . Three pools of 10 mosquito midguts were dissected after 3h and processed for microarray analysis of gene expression.

2010-02-21 | E-GEOD-20204 | biostudies-arrayexpress

Comparison of a resistant field population of Anopheles gambiae ss collected in Tiefora, Burkina Faso (2014) compared to a lab susceptible ss Anopheles gambiae Kisumu.

Project description:Comparison of a pyrethroid insecticides resistant field population of Anopheles gambiae ss collected in Tiefora, Burkina Faso (2014) compared to a lab susceptible ss Anopheles gambiae Kisumu.

2018-07-29 | E-MTAB-6500 | biostudies-arrayexpress

Met Knockdown: Anopheles gambiae, Tiassale

Project description:Transcription factor Met knockdown by dsRNA injection and compared to dsRNA-GFP injected control. Met was knocked down to determine whether it plays a role in response to traditional public health insecticides in addition to juvenile hormone homologs.

2018-09-30 | E-MTAB-4043 | biostudies-arrayexpress

Maf-S Knockdown Anopheles gambiae: Tiassale

Project description:Transcription factor Maf-S knockdown by dsRNA injection and compared to dsRNA-GFP injected control. Maf-S knockdown was performed to study the affect of xenobiotic stress of the cnc-keap1 pathway.

2017-03-19 | E-MTAB-4042 | biostudies-arrayexpress

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.

2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress

Comparison of a resistant population of Anopheles gambiae ss, from Tiefora Burkina Faso, to a lab susceptible An. gambiae ss Kisumu.

Project description:Comparison of an adult female pyrethroid insecticide resistant population of Anopheles gambiae ss, from Tiefora Burkina Faso, to a lab susceptible An. gambiae ss Kisumu sampled in 2013.

2018-07-29 | E-MTAB-6499 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data