Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Comprehensive Transcriptional Analysis of Early Stage Urothelial Carcinoma using whole transcriptome sequencing

ABSTRACT: The expression profile and sequence variants of 476 early stage urothelial carcinoma were studied using whole transcriptome sequencing. RNA-Seq libraries were prepared by Ribo-Zero treatment of total-RNA (to reduce the rRNA content) followed by library preparation using ScriptSeq. RNA-Seq libraries were paired-end sequenced (2x 101 bp) on Illumina HiSeq 2000 and the resulting fastq files were processed using tools from the Genome Analysis Toolkit (GATK and from the Tuxedo suite. Access to the sequence data (bam and vcf files), containing person identifying information, needs signature on a controlled access form, and can be accessed at The European Genome-phenome Archive (EGA) using the study ID EGAS00001001236 following request. An expression matrix of FPKM values are available without restriction at ArrayExpress.

INSTRUMENT(S): Illumina HiSeq 2000

ORGANISM(S): Homo sapiens

SUBMITTER: Jakob Hedegaard

PROVIDER: E-MTAB-4321 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

Combining transcriptome and proteome analysis to identify and characterize the RpoS regulon in Pseudomonas fluorescens

Project description:Background: Microorganisms are the major cause of food spoilage during storage, processing and distribution. Pseudomonas fluorescens is a typical spoilage bacterium that contributes to a large extent to the spoilage process of proteinaceous food. RpoS is considered an important global regulator involved in stress survival and virulence in many pathogens. Our previous work revealed that RpoS contributed to the spoilage activities of P. fluorescens by regulating resistance to different stress conditions, extracellular acylated homoserine lactone (AHL) levels, extracellular protease and total volatile basic nitrogen (TVB-N) production. However, RpoS-dependent genes in P. fluorescens remained undefined. Results: RNA-seq transcriptomics analysis combined with quantitative proteomics analysis basing on multiplexed isobaric tandem mass tag (TMT) labeling was performed for the P. fluorescens wild-type strain UK4 and its derivative carrying a rpoS mutation. A total of 375 differentially expressed genes (DEGs) and 212 differentially expressed proteins (DEPs) were identified in these two backgrounds. The DGEs were further verified by qRT-PCR tests, and the genes directly regulated by RpoS were confirmed by 5’-RACE-PCR sequencing. The combining transcriptome and proteome analysis revealed a role of this regulator in several cellular processes, including polysaccharide metabolism, intracellular secretion and extracellular structures, cell well biogenesis, stress responses, ammonia and biogenic amine production, which may contribute to biofilm formation, stress resistance and spoilage activities of P. fluorescens. Moreover, in this work we indeed observed that RpoS contributed to the production of the macrocolony biofilm’s matrix.

2019-11-12 | PXD010845 | Pride

A 3D molecular atlas of the chick embryonic heart

Project description:We performed a detailed analysis of gene expression in the 2-day (HH12) embryonic chick heart. RNA-seq of 13 microdissected heart regions reveals regionalised expression of about 15,000 genes (Dataset 1). Of these, 131 genes that are differentially expressed (FPKM ≥20, fold change ≥1.1-4.0) within a region compared to the other 12 regions were studied by in situ hybridisation (bold text in Dataset 1) and used to generate a 3D molecular map of the heart at this stage of development.

2019-10-02 | E-MTAB-7663 | biostudies-arrayexpress

Anatomical and molecular dissection of the prestreak chick embryo

Project description:This paper shows detailed information of prestreak stage chick embryos at the morphological level by using scanning electron microscopy, and at the molecular level by RNAseq and expression analysis.

2020-02-12 | E-MTAB-7941 | biostudies-arrayexpress

Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)

Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).

2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress

Response and resistance to BET bromodomain inhibitors in triple negative breast cancer [RNA-Seq]

Project description:Triple negative breast cancer (TNBC) is a heterogeneous and clinically aggressive disease for which there is no targeted therapy. Here we report the preferential and high sensitivity of TNBCs to BET bromodomain inhibitors such as JQ1 manifested by cell cycle arrest in early G1, apoptosis, and induction of markers of luminal epithelial differentiation in vitro and in vivo. The sensitivity of TNBC and other tumor types to BET inhibition establishes a rationale for clinical investigation, and a motivation to understand mechanisms of resistance. After engendering acquired resistance to BET inhibition in previously sensitive TNBCs, we utilized integrative approaches to identify a unique mechanism of epigenomic resistance to this epigenetic therapy. Resistant cells remain dependent on BRD4, confirmed by RNA interference. However, TNBC cells adapt to BET bromodomain inhibition by re-recruitment of unmutated BRD4 to super-enhancers, now in a bromodomain-independent manner. Proteomic studies of resistant TNBC identify hyper-phosphorylation of BRD4 and strong association with MED1. Together, these studies provide a rationale for BET inhibition in TNBC and argue for combination strategies to anticipate clinical drug resistance. RNA-Seq in parental and JQ1 resistant triple negative breast cancer (TNBC) in response to DMSO or JQ1 treatment over time

2016-01-07 | E-GEOD-63582 | biostudies-arrayexpress

Signaling through MyD88 in bone marrow-derived cells promotes gastric tumorigenesis by inducing the TLR2/CD14 pathway in tumor cells

Project description:Gan mice express Wnt1, Ptgs2, and Ptges, which develop inflammation-associated gastric tumors (Oshima et al, Gastroenterology 131: 1086, 2006). We examined the role of MyD88 in tumorigenesis by construction of Myd88-/- Gan mice and bone marrow transplantation into Gan mice from Myd88-/- mice. Total RNA was prepared from wild-type normal glandular stomach (n=3: WT 1âWT 3), B6 C2mE mice (n=3: C2mE 1âC2mE 3), B6 Gan mice (n=3: Gan1âGan3), B6 Gan MyD88-/- mice (n=3: Gan 1 (MyD88-/-)âGan 3 (MyD88-/-)), and B6 bone marrow transplanted Gan mice from Myd88-/- mice (n=3: BMT-Gan 1 (from MyD88-/-)âBMT-Gan 3 (from MyD88-/-)). We used Illumina HiSeq 2000, and examined expression profiles.

2015-12-15 | E-GEOD-70135 | biostudies-arrayexpress

The genome of the seagrass Zostera marina

Project description:This dataset contains the transcriptome sequence of Zostera marina as produced by Illumina sequencing. Four tissues were sequenced, female flower in late and early stages of development, the male flower, the root and leaf tissue. Full transcriptome sequencing of four tissues, including female flower at two time points in development

2016-01-16 | E-GEOD-67579 | biostudies-arrayexpress

Clinical exome sequencing of cells freshly isolated from 12 human colorectal carcinoma patients (tumor endothelial cells, normal colon endothelial cells, PBMCs, n=12 each) in comparison to microdisected tumor DNA (n=11) from corresponding FFPE-tissue blocks

Project description:Clinical exome sequencing of cells freshly isolated from 12 human colorectal carcinoma patients (tumor endothelial cells, normal colon endothelial cells, PBMCs, each n=12) in comparison to DNA isolated from microdissected tumor cells (n=11) from corresponding FFPE-tissue blocks

2023-05-01 | E-MTAB-10521 | biostudies-arrayexpress

SnapShot-Seq: a method for extracting genome-wide, in vivo mRNA dynamics from a single total RNA sample

Project description:mRNA synthesis, processing, and destruction involve a complex series of molecular steps that are incompletely understood.Â Because the RNA intermediates in each of these steps have finite lifetimes, extensive mechanistic and dynamical information is encoded in total cellular RNA. Here we report the development of SnapShot-Seq, a set of computational methods that allow the determination of in vivo rates of pre-mRNA synthesis, splicing, intron degradation, and mRNA decay from a single RNA-Seq snapshot of total cellular RNA. SnapShot-Seq can detect in vivo changes in the rates of specific steps of splicing, and it provides genome-wide estimates of pre-mRNA synthesis rates comparable to those obtained via labeling of newly synthesized RNA. We used SnapShot-Seq to investigate the origins of the intrinsic bimodality of metazoan gene expression levels, and our results suggest that this bimodality is partly due to spillover of transcriptional activation from highly expressed genes to their poorly expressed neighbors. SnapShot-Seq dramatically expands the information obtainable from a standard RNA-Seq experiment. These data are total RNA-Seq data, from RNA sequencing of rRNA-depleted total cellular RNA -- except the LCL 4SU data, which derive from 4SU-labeled RNA. Please see the associated paper for more details.

2014-02-04 | E-GEOD-48889 | biostudies-arrayexpress

Identification of proteins specifically binding to ac4C RNA probes

Project description:As a newly identified mRNA modification, the regulation of ac4C remains largely unexplored. RNA-binding proteins (RBPs) that specifically binds to ac4C modification and mediate downstream cellular activities (readers) have not been reported yet. We synthesized acetylated and non-acetylated RNA probes by in vitro transcription. The sequences of the probes were segments of FUS and 18s rRNA, which contain ac4C sites as reported. A biotin-RNA pulldown assay and mass spectrometry were performed with HEK 293T cell lysates.

2021-07-20 | PXD027014 | Pride

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data