Anatomical and molecular dissection of the prestreak chick embryo
Ontology highlight
ABSTRACT:
INSTRUMENT(S): NextSeq 500
ORGANISM(S): Gallus gallus
SUBMITTER: Claudio Stern
PROVIDER: E-MTAB-7941 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:We performed a detailed analysis of gene expression in the 2-day (HH12) embryonic chick heart. RNA-seq of 13 microdissected heart regions reveals regionalised expression of about 15,000 genes (Dataset 1). Of these, 131 genes that are differentially expressed (FPKM ≥20, fold change ≥1.1-4.0) within a region compared to the other 12 regions were studied by in situ hybridisation (bold text in Dataset 1) and used to generate a 3D molecular map of the heart at this stage of development.
2019-10-02 | E-MTAB-7663 | biostudies-arrayexpress
Project description:We used NEBNext Ultra Directional RNA Library Prep Kits to prepare RNA-seq libraries of total RNA from hnRNP A2/B1 and A1 depleted A549 cells. Pro-seq libraries were prepared from A549 cells using Illumina adapters hnRNP A2/B1 and A1 depleted A549 cells were generated by lentiviral infections of shRNA constructs. RNAs were isolated using Trizol.
2016-05-17 | E-GEOD-76151 | biostudies-arrayexpress
Project description:During early vertebrate development, signals from a special region of the embryo, the organizer, can re-direct the fate of non-neural ectoderm cells to form a complete, patterned nervous system. This is called neural induction and has generally been imagined as a single signaling event, causing a switch of fate. Here we undertake a comprehensive analysis, in very fine time-course, of the events following exposure of ectoderm to the organizer. Using transcriptomics and epigenomics we generate a Gene Regulatory Network comprising 175 transcriptional regulators and 5,614 predicted interactions between them, with fine temporal dynamics from initial exposure to the signals to expression of mature neural plate markers. Using in situ hybridization, single-cell RNA-sequencing and reporter assays we show that neural induction by a grafted organizer mimics normal neural plate development. The study is accompanied by a comprehensive resource including information about conservation of the predicted enhancers in different vertebrate systems.
2023-03-14 | E-MTAB-10424 | biostudies-arrayexpress
Project description:The transcriptome of the planarian Schmidtea mediterranea is not well characterized. We have used RNA-Seq to characterize the transcriptome in both sexual and asexual strains of S. mediterranea from both untreated and irradiated animals. Moreover, we have performed RNA-Seq on RNA purified from FACS sorted neoblasts and differentiated cells. Together these studies expand our understanding of the planarian transcriptome and have identified strain-specific, neoblast-specific, and conserved transcripts. RNA-Seq was performed on RNA isolated from untreated and irradiated S. mediterranea animals from both the sexual and asexual strains, on FACS purified X1 neoblasts, X2 neoblasts, and Xins differentiated cells. One of the raw data files for GSM847465 is missing. The fasta file is provided at http://genome.vcell.uchc.edu/GenomeData02/Graveley_Lab_Public_Data/Planarian/S.mediterranea_SexNIRmRNA3.fa.gz
2012-04-24 | E-GEOD-34326 | biostudies-arrayexpress
Project description:Mammalian spermatogenesis is a complex biological process that occurs within a highly organized tissue, the seminiferous epithelium. The coordinated maturation of spermatogonia, spermatocytes and spermatids suggests the existence of precise programs of gene expression in these cells as well as in their neighboring somatic Sertoli cells. The objective of this study was to elucidate genes encoding the proteins that execute these programs. Rat seminiferous tubules at stages I, II-III, IV-V, VI, VIIa,b, VIIc,d, VIII, IX-XI, XII, XIII-XIV of the cycle were isolated by microdissection and Sertoli cells, spermatogonia plus early spermatocytes, pachytene spermatocytes and spermatids were purified from enzymatically-dispersed testes. Microarray analysis using Rat Genome 230 2.0 arrays identified a total of 16,971 probe sets that recognized transcripts. A comparison with the transcriptome of other tissues identified 398 testis-specific probe sets, which therefore are potential targets for the development of new contraceptives. Sequential waves of cell and stage-specific gene expression are associated with progression of germ cells through the stages of the cycle of the seminiferous epithelium and 1612 probe sets recognized transcripts whose expressions varied at least 4-fold across the stages of the cycle. Pathway analyses reveal that entire biological processes are regulated cyclically in testicular cells. Important among these are cell cycle and DNA repair. Thus, stage-specific gene expression is a widespread and fundamental characteristic of spermatogenic cells and Sertoli cells. Experiment Overall Design: Seminiferous tubules at the following stages or groups of stages were isolated by transillumination-assisted microdissection: I, II-III, IV-V, VI, VIIa,b, VIIc,d, VIII, IX-XI, XII, XIII-XIV. Twenty-five segments of tubules, 2 m in length, were collected at each stage or group of stages from each rat. Tubules from two separate animals were pooled to form one sample from each stage or groups of stages. A total of 5 independent samples per stage or groups of stages were analyzed. Mature Sertoli cells were isolated to about 85% purity (n=4). Three groups of germ cells were isolated by centrifugal elutriation from enzyme-dispersed testes: round spermatids (n=4), pachytene spermatocytes (n=4) and spermatogonia plus early spermatocytes (n=3) . Purity of these cells has been shown to vary between 85% to 95%
2008-06-20 | E-GEOD-8978 | biostudies-arrayexpress
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress
Project description:Eight different types of sample (three samples each) were used in this study of cardiac cell migration in the tunicate Ciona intestinalis. The B7.5 lineage cells were isolated by Fluorescent Activated Cell Sorting (FACS) at the tailbud stage, when the cardiac precursors (anterior B7.5 lineage cells) are migrating into the trunk, while their sister cells (posterior 7.5 lineage cells) remain in the tail, where they form muscle cells. Cells were sorted at the late gastrula stage, prior to migration induction and after manipulation of the FGF-MAPK-Ets signaling pathway (targeted expression of dominant negative FGF receptor and Ets:VP16 fusion protein, targeted expression was achieved using the Mesp cis-regulatory DNA), FoxF function (a direct target of FGF-MAPK-Ets signaling, required primarily for cell migration) by targeted expression of FoxF:VP16 (constitutive activator) or FoxF:WRPW (constitutive repressor, dominant negative), Mesp function (over-expression of Mesp:VP16 inhibits primarily cell migration). Finally, the "whole embryo" samples were collected from dissociated whole tailbud embryos, without FACS. in summary the eight conditions are: "wt (files LC-wt-1,-2,-3)": wild_type B7.5 lineage cells, expressing GFP, sorted at the tailbud stage "Ets:VP16 (files LC-EV-1,-2,-3)": B7.5 lineage cells, expressing GFP and Ets:VP16, sorted at the tailbud stage "DnFGFR (files LC-dnFGFR-1,-2,-3)": B7.5 lineage cells, expressing GFP and dominant-negative FGF receptor, sorted at the tailbud stage. "FoxF:VP16 (files LC-FV-1,-2,-3)": B7.5 lineage cells, expressing GFP and FoxF:VP16, sorted at the tailbud stage. "FoxF:WRPW (files LC-FW-1,-2,-3)": B7.5 lineage cells, expressing GFP and FoxF:WRPW, sorted at the tailbud stage". "Mesp:VP16 (files LC-MV-1,-2,-3)": B7.5 lineage cells, expressing GFP and Mesp:VP16, sorted at the tailbud stage. "Late Gastrula (files LC-LG-1,-2,-3)": wild_type B7.5 lineage cells, expressing GFP, sorted at the late gastrula stage "whole embryo (files LC-whole-1,-2,-3": whole embryos, dissociated at the tailbud stage, not sorted.
2008-06-01 | E-MEXP-1478 | biostudies-arrayexpress
Project description:Many long-lived species of animals require the function of adult stem cells throughout their lives. However, the transcriptomes of stem cells in invertebrates and vertebrates have not been compared, and consequently ancestral regulatory circuits that control stem cell populations remain poorly defined. In this study, we have used data from high-throughput RNA sequencing (RNA-Seq) to compare the transcriptomes of pluripotent adult stem cells from planarians with the transcriptomes of human and mouse pluripotent embryonic stem cells. From a stringently-defined set of 4,432 orthologs shared between planarians, mice and humans, we identified 123 conserved genes that are ≥ 5-fold differentially expressed in stem cells from all three species. Guided by this gene set, we used RNAi screening in adult planarians to discover novel stem cell regulators, which we found to affect the stem cell-associated functions of tissue homeostasis, regeneration, and stem cell maintenance. Examples of genes that disrupted these processes included the orthologs of TBL3, PSD12, TTC27, and RACK1. From these analyses, we concluded that by comparing stem cell transcriptomes from diverse species, it is possible to uncover conserved factors that function in stem cell biology. These results provide insights into which genes composed the ancestral circuitry underlying the control of stem cell self-renewal and pluripotency. Three planarian tissues were analyzed: stem cells, stem cell progeny, and differentiated tissues. For the manuscript: Labbe, RM, et. al., 2012, Stem Cells
2012-06-01 | E-GEOD-37910 | biostudies-arrayexpress
Project description:During early vertebrate development, signals from a special region of the embryo, the organizer, can re-direct the fate of non-neural ectoderm cells to form a complete, patterned nervous system. This is called neural induction and has generally been imagined as a single signaling event, causing a switch of fate. Here we undertake a comprehensive analysis, in very fine time-course, of the events following exposure of ectoderm to the organizer. Using transcriptomics and epigenomics we generate a Gene Regulatory Network comprising 175 transcriptional regulators and 5,614 predicted interactions between them, with fine temporal dynamics from initial exposure to the signals to expression of mature neural plate markers. Using in situ hybridization, single-cell RNA-sequencing and reporter assays we show that neural induction by a grafted organizer mimics normal neural plate development. The study is accompanied by a comprehensive resource including information about conservation of the predicted enhancers in different vertebrate systems.
2023-03-14 | E-MTAB-10420 | biostudies-arrayexpress
Project description:In order to understand molecular basis of cardiac ageing in killifish, we have performed RNA Seq on the ventricular regions of young and aged killifish. Experiment was performed in biological triplicates.
2019-03-22 | E-MTAB-7582 | biostudies-arrayexpress