ChIP-chip of RNAP in E. coli MG1655 exposed to acetate
Ontology highlight
ABSTRACT:
ORGANISM(S): Escherichia coli
SUBMITTER: Susan Black
PROVIDER: E-MTAB-590 | biostudies-arrayexpress |
REPOSITORIES: biostudies-arrayexpress
Similar Datasets
Project description:We have analysed the genome-wide distribution of RNA polymerase in mechanosenstive deletion strains of E.coli upon hyperosmotic stress. We have used ChIP-chip of the ß subunit of RNA polymerase and we have assessed changes in RNA polymerase distribution in Frag1 MJF612 and MJF641 strains that are deleted for incresing numbers of mechanosensitive channels in response to hyperosmotic stress .
2012-03-30 | E-MTAB-592 | biostudies-arrayexpress
Project description:We have analyzed the genome-wide redistribution of RNA polymerase in E.coli upon methylglyoxal stress. Herefore, we have used ChIP-chip against the beta subunit of RNA polymerase and we have assessed changes in RNA polymerase distribution upon sub-lethal and lethal concentrations of methylglyoxal.
2011-12-15 | E-MTAB-100 | biostudies-arrayexpress
Project description:This study was undertaken to identify novel tumour suppressor genes in lung adenocarcinoma. EYA4, located at 6q23.2 was identified as a frequently lost and hypermethylated gene in the analyzed samples. EYA4 is underexpressed in addition to being deleted and hypermethylated. Control of EYA4 expression by DNA methylation was assessed using 5'-azacytidine. The role of EYA4 in apoptosis was assessed using a stable knock down of the gene which was assessed for apoptotis using FACS and qPCR. Methylation profiling: 30 adenocarcinoma samples and 30 patient-matched non-malignant lung samples are included. Non-malignant samples were used as references to identify hypermethylated probes. For each normal/tumor pair, the sample numbers are paired but offset by one with the tumor being the lower of the two numbers. For example, 85040001 is the adenocarcinoma tumor profile that pairs with non-malignant 85040002. Genome variation (aCGH) profiling: 30 adenocarcinoma gene dosage profiles are included. Values presented are log2 ratios of Cy3(sample)/Cy5(diploid reference)
2014-02-25 | E-GEOD-19034 | biostudies-arrayexpress
Project description:We performed transcriptome abundance analysis of Salmonella Typhimurium strain SL1344 swap which has been genetically engineered to express the hns open-reading frame from the stpA promoter and the stpA open reading frame from the hns promoter. This strain is designated SL1344(swap). Transcript abundance was compared with that of wild-type SL1344. This comparison was performed to determine the effect of chromosome location of the expression of two related global regulators and how alterations to their expression patterns would impact on their regulons. Three independent RNA samples were harvested from wild-type SL1344 and SL1344(swap) grown to exponential phase (OD600nm = 0.3) and hybridized to a microarray containing multiple probes for each of the SL1344 open reading frames. Please note that the original raw data file for the 'SL1344_wildtype_BR2' sample is unavailable, however, the 'wildtype SL1344 BR2.gpr' contains the raw data missing only the header information.
2013-11-09 | E-GEOD-52235 | biostudies-arrayexpress
Project description:Pharmaceuticals are pseudo persistent aquatic pollutants with unknown effects at environmentally relevant concentrations. Atlantic salmon (Salmo salar) were exposed to Acetaminophen: 54.77 ± 34.67; Atenolol: 11.08 ± 7.98 and Carbamazepine: 7.85 ± 0.13 µg•L-1 for 5 days. After Acetaminophen treatment, 19 proteins were differently expressed, of which 11 were significant with respect to the control group (eight up-regulated and three down-regulated). After Atenolol treatment, 7 differently expressed proteins were obtained in comparison with the control, of which 6 could be identified (four up-regulated and 2 down-regulated). Carbamazepine exposure resulted in 15 differently expressed proteins compared with the control, with 10 of them identified (seven up-regulated and three down-regulated). Out of these, 3 features were common between Acetaminophen and Carbamazepine and one between Carbamazepine and Atenolol. One feature was common across all treatments. Principal component analysis and heat map clustering showed a clear grouping of the variability due to the applied treatments. The obtained data suggest (1) that exposure to environmentally relevant concentrations of the pharmaceuticals alters the hepatic protein expression profile of the Atlantic salmon; and (2) the existence of treatment specific processes that may be useful for biomarker development.
2014-11-18 | PXD001354 | Pride
Project description:Transcriptional profiling of Salmonella Typhimurium strains SL1344 (pSfR27) and SL1344 (pSfR27) delta sfh to identify 'Sfh-dependent' transcripts Two condition experiment in which the transcriptomes of wild-type SL1344 (pSfR27) and SL1344 (pSfR27) delta sfh were compared to identify 'Sfh-dependent' transcripts
2010-05-18 | E-GEOD-19230 | biostudies-arrayexpress
Project description:long-read CAGE was design to identify full length capped transcript across 10 specific loci in cortical neurones. Long-read CAGE was based on the Cap-Trapper method with the full length cDNA sequencing using ONT MinION sequencer. After RNA extraction, 10 µg total RNAs from Human iPS (WTC-11) cells, differentiated neural stem cells and differentiated cortical neuron cells were polyadenylated with E-coli poly(A) Polymerase (PAP) (NEB M0276) at 37°C for 15 min and purified with AMPure RNA Clean XP beads. The PAP treated 5 µg RNA was reverse transcribed with oligodT_16VN_UMI25_primer (GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTTTTTTTTTTTTTTTTVN) and Prime Script II Reverse Transcriptase (Takara Bio) at 42°C for 60 min and purified with RNAClean XP beads. Cap-trapping from the RNA/cDNA hybrids was performed with published protocol (Takahashi et al., Nature protocols, 2012 (https://doi.org/10.1038/nprot.2012.005)), and RNA was digested with RNase H (Takara Bio) at 37°C for 30 min and purified with AMPureXP beads. 5’ linker (N6 up GTGGTATCAACGCAGAGTACNNNNNN-Phos, GN5 up GTGGTATCAACGCAGAGTACGNNNNN-Phos, down Phos-GTACTCTGCGTTGATACCAC-Phos) was ligated to the cDNA with Mighty Mix (Takara Bio) for overnight and the ligated cDNA was purified with AMPure XP beads. Shrimp Alkaline Phosphatase (Takara Bio) was used to remove phosphates at the ligated linker and purified with AMPureXP beads. The 5’ linker ligated cDNA was then second strand synthesized with KAPA HiFi mix (Roche) and 2nd synthesis primer_UMI15 at 95°C for 5 min, 55°C for 5 min and 72°C for 30 min. Exonuclease I (Takara Bio) was added for the primer digestion at 37°C for 30 min, and the cDNA/DNA hybrid was purified with AMPureXP and amplified with PrimerSTAR GXL DNA polymerase (Takara Bio) and PCR primer (fwd_CTACACTCGTCGGCAGCGTC, rev _GAGATGTCTCGTGGGCTCGG) for 7 cycles. The library was then treated with SQK-LSK110 (Oxford Nanopore Technologies) with manufacture’s protocol and sequenced with R9.4 flowcell (FLO-MIN106) in MinION sequencer. Basecalling was processed by Guppy v5.0.14 basecaller software provided by Oxford Nanopore Technologies to generate fastq files from FAST5 files. To prepare clean reads from fastq files, adapter sequence was trimmed by pychopper (https://github.com/nanoporetech/pychopper) with VNP_GAGATGTCTCGTGGGCTCGGNNNNNNNNNNNNNNNCTACG and SSP_ CTACACTCGTCGGCAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNGTGGTATCAACGCAGAGTAC and the fastq was mapped on our target genes.
2024-10-08 | E-MTAB-14500 | biostudies-arrayexpress
Project description:Zinc (Zn) is an essential trace element for all life forms. Zn supplementation has been used to treat diarrheal disease in children, and in the U.S. swine industry at pharmacological levels to promote growth and fecal consistency, but underlying mechanisms explaining these beneficial effects remain unknown. Thus, we hypothesized that the benefits of pharmacological Zn supplementation were a result of changes in gene expression. For this study, liver RNA from newly weaned pigs fed dietary Zn as Zn oxide for 14 days at either adequate (150 Zn/kg) or pharmacological (2000 mg Zn/kg) levels was evaluated using a 70-mer oligonucleotide microarray. Interrogation of this microarray revealed 658 annotated transcripts (FDR ≤ 0.05) affected by pharmacological Zn supplementation. Relative real-time RT-PCR was used to confirm differential expression of two genes. Results suggest that feeding pharmacological Zn (2000 mg Zn/kg) affects genes involved in reducing oxidative stress and in amino acid metabolism, which are essential for cell detoxification and proper cell function. Oligonucleotide microarrays used for this study consisted of 13,297 70-mer oligos (Pig Array-Ready Oligo Set v. 1.0 and Pig Oligo Extension Set v. 1.0, Qiagen, Inc., Valencia, CA) each spotted once on a single slide. Slides were printed at the Michigan State University Research Technology Support Facility. Oligonucleotides spotted in multiple locations for use as potential controls included 76 Arabidopsis thaliana gene spots, 17 beta tubulin spots, 17 glyceraldehyde-3-phosphate dehydrogenase spots, 85 heat shock protein gene spots, 69 ribosomal protein gene spots, 112 randomly generated negative control spots and 470 blanks. The microarray was screened with the Zn150 and Zn2000 samples, and four microarray slides were screened. Zn150 samples were randomly paired with Zn2000 samples. Two samples from each treatment were labeled with Cy3 and the other two were labeled with Cy5.
2008-10-02 | E-GEOD-11972 | biostudies-arrayexpress
Project description:This SuperSeries is composed of the following subset Series: GSE19230: The effect of sfh deletion on Salmonella Typhimurium gene expression GSE19231: Identification of Sfh and H-NS binding sites in the Salmonella Typhimurium genome Refer to individual Series
2010-05-18 | E-GEOD-19356 | biostudies-arrayexpress
Project description:Transcriptional profiling of Q0990 x bdl vs Q0990 x Col-0 development embryos after 3days and 6 days of fertilization Two conditional experiments: Q0990 x bdl vs Q0990 x Col-0, and two satges was compared: 3days and 6 days after fertilization. . 4 biological replicates for each experiment. The submitter states that the Agilent Feature Extraction files have been lost: the original files was stored in a unrecoverable crashed computer, because the Base 2 in my institute is not in service anymore, so I can not re-download my file with the Agilent Feature
2016-02-26 | E-GEOD-78695 | biostudies-arrayexpress