Browse
Submit Data
Databases
API
Help

Unknown,Transcriptomics,Genomics,Proteomics

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

4C-Seq identify the interaction between miR-146a promoter and rs2431697-containing region

ABSTRACT: To test the genomic region containing rs2431697 whether forms a cognate enhancer-promoter loop with the miR-146a promoter and modulates the expression of miR-146a, we perfomed 4C-seq in U-937 cell line based on the rs2431697 view point and miR-146a promoter view point.

INSTRUMENT(S): HiSeq X Ten

ORGANISM(S): Homo sapiens

SUBMITTER: Nan Shen

PROVIDER: E-MTAB-8974 | biostudies-arrayexpress |

REPOSITORIES: biostudies-arrayexpress

ACCESS DATA

Json Xml

Similar Datasets

4C-Seq identify the interaction between miR-146a promoter and rs2431697-containing region

Project description:To test the genomic region containing rs2431697 whether forms a cognate enhancer-promoter loop with the miR-146a promoter and modulates the expression of miR-146a, we perfomed 4C-seq in U-937 cell line based on miR-146a promoter view point (First digestion enzyme MboI, second digestion enzyme NlaIII) and rs2431697 view point (First digestion enzyme CSP6I, second digestion enzyme NlaIII).

2020-11-05 | E-MTAB-9581 | biostudies-arrayexpress

4C-Seq identifies the chromatin interaction landscape of the miR-146a promoter region

Project description:To test the chromatin interaction landscape of the miR-146a promoter region, we performed 4C-seq in JURKAT and RAJI cell lines based on the miR-146a promoter viewpoint. (First digestion enzyme MboI, second digestion enzyme NlaIII)

2023-06-19 | E-MTAB-13082 | biostudies-arrayexpress

4C-Seq identify the interaction between IRF8 promoter and rs2280381-containing region

Project description:To test if there is a physical interaction between the IRF8 promoter and the rs2280381-containing region, we conducted circular chromatin conformation capture assay in the U937 cell. For the IRF8 viewpoint group, we used CSP6I as the first digested enzyme and NlaIII as the second enzyme. For the rs2280381-containing region, we used MboI as the first digested enzyme and NlaIII as the second enzyme. We use 4C-PCR primer to construct IRF8 point view and rs2280381-containing region 4C library.

2021-07-01 | E-MTAB-10120 | biostudies-arrayexpress

4C-Seq identify the interaction between IRF8 promoter and rs2280381-containing region in human primary monocyte

Project description:To test if lncRNA AC092723.1 play a role in physical interaction between the IRF8 promoter and the rs2280381-containing region, we conducted circular chromatin conformation capture assay in the human primary monocyte. We knock down lncRNA AC092723.1 by electro-transfecting ASOs, the control group is transfected negtive ASOs with no impact on lncRNA AC092723.1.We used CSP6I as the first digested enzyme and NlaIII as the second enzyme. After constructing 4C library,we then utilize 4C-PCR primer to construct IRF8 point view 4C library.

2022-02-25 | E-MTAB-11175 | biostudies-arrayexpress

Gene expression profiling in Salmonella Typhimurium encountered with heterophils

Project description:To study the pathogenicity of Salmonella Typhimurium (ST) in heterophils, a whole Salmonella genome array was used to analyze RNA isolated from Salmonella in vitro encountered with heterophils (30 min, 1 h, 2 h, and 3 h) or medium control (NS). Dual-color, direct comparisons were carried out between heterophils-encountered ST and non-encountered controls (30 min vs. NS (30M/NS), 1 h vs. NS (1HR/NS), 2 h vs. NS (2HR/NS) and 3 h vs. NS (3HR/NS)). Each comparison includes four biological replicates. Out of 4588 genes on an array, there were 605, 758, 944 and 945 genes differentially expressed in the comparisons of 30M/NS, 1HR/NS, 2HR/NS and 3HR/NS, respectively (P < 0.001, fold-change > 2). Most of the Salmonella genes associated with invasion function were found differentially expressed at 2HR/NS and 3HR/NS comparisons. These candidate genes include TypeIII-secreted protein effector sopE2, Invasion proteins (e.g. invA, invE, invG, invH), and Invasion genes tranction activator hilA. The results of continuous transcriptional changes provide important information to elucidate the pathogenicity of ST in heterophils. Dual-color, common reference comparisons were carried out between heterophils-encountered ST and non-encountered controls (30 min vs. NS (30M/NS), 1 h vs. NS (1HR/NS), 2 h vs. NS (2HR/NS) and 3 h vs. NS (3HR/NS)). Four biological replicates, with dye swap labeling, were included in each of comparisons. Background subtracted signal intensity were collected from 16 arrays and normalized before data analysis.

2011-01-01 | E-GEOD-16399 | biostudies-arrayexpress

Alterations of RNA maps of IncP-7 plasmid pCAR1 in various Pseudomonas bacteria.

Project description:RNA mapping on pCAR1 carried by KT2440, CA10, PAO1, Pf0-1, HS01, and JCM 2778 6 strains/biological entities were compared

2011-10-10 | E-GEOD-28568 | biostudies-arrayexpress

RNA-Seq of Brachypodium distachyon callus treated with methyl-jasmonate

Project description:The aim was to determine the changes in cell wall composition and transcriptome changes following treatment with the stress hormone precursor methyl jasmonate (MeJA) in the model grass Brachypodium distachyon. The correlation between transcript changes and cell wall composition changes allowed identification of candidate genes responsible for grass-specific features of the cell wall that are specifically changed in response to MeJA.

2017-09-04 | E-MTAB-5413 | biostudies-arrayexpress

Med1 facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.

2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress

4C sequencing for the SOX11 promoter in the neuroblastoma cell lines CLB-GA, KELLY, SK-N-AS and SH-EP

Project description:4C sequencing for the SOX11 promoter in the neuroblastoma cell lines CLB-GA, KELLY, SK-N-AS and SH-EP.

2023-02-19 | E-MTAB-12580 | biostudies-arrayexpress

Cooperative function of the three different kinds of nucleoid-associated proteins encoded on the IncP-7 plasmid pCAR1 [KT2440 chromosome chip]

Project description:Nucleoid-associated proteins (NAPs) are known to fold bacterial DNA and influence global transcription. Incompatibility P-7 plasmid pCAR1 carries three genes encoding NAPs: H-NS family protein Pmr, NdpA-like protein Pnd, and HU-like protein Phu. Because previous reports about plasmid-encoded NAPs mainly focused on H-NS homologs, functions and importance of different kinds of NAPs encoded on a plasmid remained unknown. Here, we assessed the effects of single or double disruption of pmr, pnd, and phu in a host P. putida KT2440. When pmr and pnd or pmr and phu were disrupted simultaneously, stability and conjugation frequency of pCAR1 decreased significantly. In the comprehensive phenotypes comparisons, host availabilities of some compounds, which were reduced by pCAR1carriage, were restored by NAP-gene(s)-disruption. Transcriptome analyses showed that Pmr and Pnd have different regulons, whereas Phu mainly supports their gene regulation. These cooperative functions of the three NAPs were not simply due to protein-protein interactions because hetero-oligomers of them were not detected in pull-down assays. Our present study is the first report about the cooperative function of plasmid-encoded different kinds of NAPs, which show no homology with each other. The NAPs-dependent change of chromosomal RNA maps in early exponential phases.

2013-12-07 | E-GEOD-53067 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data