Dataset Information

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

ABSTRACT: The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

SUBMITTER: Horiuchi T

PROVIDER: S-EPMC135454 | biostudies-literature | 2002 Dec

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

Horiuchi Takayuki T Akiyama Takuya T Inouye Sumiko S Komano Teruya T

Journal of bacteriology 20021201 24

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and ...[more]

PMID: 12446630

Similar Datasets

Project description:BackgroundThe Myxococcales are well known for their predatory and developmental social processes, and for the molecular complexity of regulation of these processes. Many species within this order have unusually large genomes compared to other bacteria, and their genomes have many genes that are unique to one specific sequenced species or strain. Here, we describe RNAseq based transcriptome analysis of the FruA regulon of Myxococcus xanthus and a comparative RNAseq analysis of two Myxococcus species, M. xanthus and Myxococcus stipitatus, as they respond to starvation and begin forming fruiting bodies.ResultsWe show that both species have large numbers of genes that are developmentally regulated, with over half the genome showing statistically significant changes in expression during development in each species. We also included a non-fruiting mutant of M. xanthus that is missing the transcriptional regulator FruA to identify the direct and indirect FruA regulon and to identify transcriptional changes that are specific to fruiting and not just the starvation response. We then identified Interpro gene ontologies and COG annotations that are significantly up- or down-regulated during development in each species. Our analyses support previous data for M. xanthus showing developmental upregulation of signal transduction genes, and downregulation of genes related to cell-cycle, translation, metabolism, and in some cases, DNA replication. Gene expression in M. stipitatus follows similar trends. Although not all specific genes show similar regulation patterns in both species, many critical developmental genes in M. xanthus have conserved expression patterns in M. stipitatus, and some groups of otherwise unstudied orthologous genes share expression patterns.ConclusionsBy identifying the FruA regulon and identifying genes that are similarly and uniquely regulated in two different species, this work provides a more complete picture of transcription during Myxococcus development. We also provide an R script to allow other scientists to mine our data for genes whose expression patterns match a user-selected gene of interest.

Dataset Information

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

Publications

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets