Browse
Submit Data
Databases
API
Help

Dataset Information

25 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Both introns and long 3'-UTRs operate as cis-acting elements to trigger nonsense-mediated decay in plants.

ABSTRACT: Nonsense-mediated mRNA decay (NMD) is a eukaryotic quality control mechanism that identifies and eliminates aberrant mRNAs containing a premature termination codon (PTC). Although, key trans-acting NMD factors, UPF1, UPF2 and UPF3 are conserved in yeast and mammals, the cis-acting NMD elements are different. In yeast, short specific sequences or long 3'-untranslated regions (3'-UTRs) render an mRNA subject to NMD, while in mammals' 3'-UTR located introns trigger NMD. Plants also possess an NMD system, although little is known about how it functions. We have elaborated an agroinfiltration-based transient NMD assay system and defined the cis-acting elements that mediate plant NMD. We show that unusually long 3'-UTRs or the presence of introns in the 3'-UTR can subject mRNAs to NMD. These data suggest that both long 3'-UTR-based and intron-based PTC definition operated in the common ancestors of extant eukaryotes (stem eukaryotes) and support the theory that intron-based NMD facilitated the spreading of introns in stem eukaryotes. We have also identified plant UPF1 and showed that tethering of UPF1 to either the 5'- or 3'-UTR of an mRNA results in reduced transcript accumulation. Thus, plant UPF1 might bind to mRNA in a late, irreversible phase of NMD.

SUBMITTER: Kertesz S

PROVIDER: S-EPMC1693880 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Identification of elements in human long 3' UTRs that inhibit nonsense-mediated decay.

Project description:The nonsense-mediated mRNA decay (NMD) pathway serves an important role in gene expression by targeting aberrant mRNAs that have acquired premature termination codons (PTCs) as well as a subset of normally processed endogenous mRNAs. One determinant for the targeting of mRNAs by NMD is the occurrence of translation termination distal to the poly(A) tail. Yet, a large subset of naturally occurring mRNAs contain long 3' UTRs, many of which, according to global studies, are insensitive to NMD. This raises the possibility that such mRNAs have evolved mechanisms for NMD evasion. Here, we analyzed a set of human long 3' UTR mRNAs and found that many are indeed resistant to NMD. By dissecting the 3' UTR of one such mRNA, TRAM1 mRNA, we identified a cis element located within the first 200 nt that inhibits NMD when positioned in downstream proximity of the translation termination codon and is sufficient for repressing NMD of a heterologous reporter mRNA. Investigation of other NMD-evading long 3' UTR mRNAs revealed a subset that, similar to TRAM1 mRNA, contains NMD-inhibiting cis elements in the first 200 nt. A smaller subset of long 3' UTR mRNAs evades NMD by a different mechanism that appears to be independent of a termination-proximal cis element. Our study suggests that different mechanisms have evolved to ensure NMD evasion of human mRNAs with long 3' UTRs.

| S-EPMC4408796 | biostudies-literature

Characterization of cis-acting sequences and decay intermediates involved in nonsense-mediated mRNA turnover.

Project description:Several lines of evidence indicate that the processes of mRNA turnover and translation are intimately linked and that understanding this relationship is critical to elucidating the mechanism of mRNA decay. One clear example of this relationship is the observation that nonsense mutations can accelerate the decay of mRNAs in a process that we term nonsense-mediated mRNA decay. The experiments described here demonstrate that in the yeast Saccharomyces cerevisiae premature translational termination within the initial two-thirds of the PGK1 coding region accelerates decay of that transcript regardless of which of the stop codons is used. Nonsense mutations within the last quarter of the coding region have no effect on PGK1 mRNA decay. The sequences required for nonsense-mediated mRNA decay include a termination codon and specific sequences 3' to the nonsense mutation. Translation of two-thirds of the PGK1 coding region inactivates the nonsense-mediated mRNA decay pathway. This observation explains why carboxyl-terminal nonsense mutations are resistant to accelerated decay. Characterization of the decay of nonsense-containing HIS4 transcripts yielded results mirroring those described above, suggesting that the sequence requirements described for the PGK1 transcript are likely to be a general characteristic of this decay pathway. In addition, an analysis of the decay intermediates of nonsense-containing mRNAs indicates that nonsense-mediated mRNA decay flows through a pathway similar to that described for a class of wild-type transcripts. The initial cleavage event occurs near the 5' terminus of the nonsense-containing transcript and is followed by 5'-->3' exonucleolytic digestion. A model for nonsense-mediated mRNA decay based on these results is discussed.

| S-EPMC231957 | biostudies-other

Role of cis-acting elements in the control of SERCA2b Ca2+ pump mRNA decay by nuclear proteins.

Project description:Alternative splicing at position 3495 b yields SERCA2 (sarco/endoplasmic reticulum Ca2+ pump 2) RNA species, namely SERCA2a and SERCA2b which differ in 3'-end regions. This results in SERCA2b RNA being less stable. In vitro decay experiments show that, in the presence of protein extracts from nuclei of LVMs (left ventricular myocytes), the rate of decay of both SERCA2b RNA and synthetic RNA from its 3'-region is greater than that of the corresponding SERCA2a RNA. To search for cis-acting instability elements in the 3'-region of SERCA2b, we examined the effects of LVM nuclear protein extracts on the in vitro decay of six short overlapping capped [m7G(5')ppp(5')Gm] and polyadenylated (A40) RNA fragments from the 3'-end region (3444-4472) of SERCA2b. The proximal fragment 2B1 (3444-3753) was the most unstable. 2B1 RNA without a cap or a polyadenylated tail was analysed further in electrophoretic mobility-shift assays, and was observed to bind to protein(s) in the nuclear extracts. Based on competition for binding to nuclear proteins between radiolabelled 2B1 RNA and short unlabelled RNA fragments, the cis-acting element involved in this binding was the sequence 2B1-4. 2B1-4 is a 35-base (3521-3555, CCAGUCCUGCUCGUUGUGGGCGUGCACCGAGGGGG) GC-rich region just past the splice site (3495). Nuclear extracts decreased the electrophoretic mobility of the radiolabelled 2B1-4 RNA which bound to two proteins (19 and 21 kDa) in cross-linking experiments. Excess 2B1-4 RNA decreased the decay of the 2B1 RNA by the nuclear protein extract. 2B1-del 4 RNA (2B1 with the 2B1-4 domain deleted) also decayed more slowly than the control 2B1 RNA. Thus SERCA2b contains a novel GC-rich cis-acting element involved in its decay by nuclear proteins.

| S-EPMC1186718 | biostudies-literature

Long 3'-UTRs target wild-type mRNAs for nonsense-mediated mRNA decay in Saccharomyces cerevisiae.

Project description:The nonsense-mediated mRNA decay (NMD) pathway, present in most eukaryotic cells, is a specialized pathway that leads to the recognition and rapid degradation of mRNAs with premature termination codons and, importantly, some wild-type mRNAs. Earlier studies demonstrated that aberrant mRNAs with artificially extended 3'-untranslated regions (3'-UTRs) are degraded by NMD. However, the extent to which wild-type mRNAs with long 3'-UTRs are degraded by NMD is not known. We used a global approach to identify wild-type mRNAs in Saccharomyces cerevisiae that have longer than expected 3'-UTRs, and of these mRNAs tested, 91% were degraded by NMD. We demonstrate for the first time that replacement of the natural, long 3'-UTR from wild-type PGA1 mRNA, which encodes a protein that is important for cell wall biosynthesis, with a short 3'-UTR renders it immune to NMD. The natural PGA1 3'-UTR is sufficient to target a NMD insensitive mRNA for decay by the NMD pathway. Finally, we show that nmd mutants are sensitive to Calcofluor White, which suggests that the regulation of PGA1 and other cell wall biosynthesis proteins by NMD is physiologically significant.

| S-EPMC2685090 | biostudies-other

Cryptic Amyloidogenic Elements in the 3' UTRs of Neurofilament Genes Trigger Axonal Neuropathy.

Project description:Abnormal protein aggregation is observed in an expanding number of neurodegenerative diseases. Here, we describe a mechanism for intracellular toxic protein aggregation induced by an unusual mutation event in families affected by axonal neuropathy. These families carry distinct frameshift variants in NEFH (neurofilament heavy), leading to a loss of the terminating codon and translation of the 3' UTR into an extra 40 amino acids. In silico aggregation prediction suggested the terminal 20 residues of the altered NEFH to be amyloidogenic, which we confirmed experimentally by serial deletion analysis. The presence of this amyloidogenic motif fused to NEFH caused prominent and toxic protein aggregates in transfected cells and disrupted motor neurons in zebrafish. We identified a similar aggregation-inducing mechanism in NEFL (neurofilament light) and FUS (fused in sarcoma), in which mutations are known to cause aggregation in Charcot-Marie-Tooth disease and amyotrophic lateral sclerosis, respectively. In summary, we present a protein-aggregation-triggering mechanism that should be taken into consideration during the evaluation of stop-loss variants.

| S-EPMC4833435 | biostudies-literature

Ribosome collisions trigger cis-acting feedback inhibition of translation initiation.

Project description:Translation of aberrant mRNAs can cause ribosomes to stall, leading to collisions with trailing ribosomes. Collided ribosomes are specifically recognised by ZNF598 to initiate protein and mRNA quality control pathways. Here we found using quantitative proteomics of collided ribosomes that EDF1 is a ZNF598-independent sensor of ribosome collisions. EDF1 stabilises GIGYF2 at collisions to inhibit translation initiation in cis via 4EHP. The GIGYF2 axis acts independently of the ZNF598 axis, but each pathway's output is more pronounced without the other. We propose that the widely conserved and highly abundant EDF1 monitors the transcriptome for excessive ribosome density, then triggers a GIGYF2-mediated response to locally and temporarily reduce ribosome loading. Only when collisions persist is translation abandoned to initiate ZNF598-dependent quality control. This tiered response to ribosome collisions would allow cells to dynamically tune translation rates while ensuring fidelity of the resulting protein products.

| S-EPMC7381030 | biostudies-literature

Cell-specific transcription of the smooth muscle gamma-actin gene requires both positive- and negative-acting cis elements.

Project description:We have characterized the function of putative regulatory sequences upon the smooth muscle transcription of the SMGA gene, using promoter deletion analyses. We demonstrate that the SMGA promoter contains four domains: a basal promoter (-1 to -100), a smooth muscle specifier sequence (-100 to -400), a negative regulator (-400 to -1000), and a smooth muscle-specific modulator (-1000 to -2000). The basal or core promoter supports equivalent transcription in both smooth and skeletal muscle cells. Addition of sequences containing a CArG motif juxtaposed to an E-box element stimulates smooth muscle transcription by five- to sixfold compared to skeletal muscle. This smooth muscle-specific segment is maintained for about 200 bp, after which is a segment of DNA that appears to inhibit the transcriptional capacity of the SMGA promoter in smooth muscle cells. Within the boundary between the smooth muscle specifier and negative regulatory sequences (-400 to -500) are three E-box elements. The smooth muscle modulator domain contains two CArG elements and multiple E-boxes. When added to the SMGA promoter it causes an additional three- to fivefold increase in smooth muscle-specific transcription over that stimulated by the smooth muscle specifier domain. Thus, our studies show that the appropriate cell-specific transcription of the SMGA gene involves complex interactions directed by multiple cis-acting elements. Moreover, our characterization of a cell culture system employing embryonic gizzard smooth muscle cells lays the foundation for further molecular analyses of factors that regulate or control SMGA and other smooth muscle genes during differentiation.

| S-EPMC6190202 | biostudies-literature

Ribosome collisions trigger cis-acting feedback inhibition of translation initiation

Project description:Translation of aberrant mRNAs can cause ribosomes to stall, leading to collisions with trailing ribosomes. Collided ribosomes are specifically recognized by ZNF598 to initiate protein and mRNA quality control pathways. Here we found using quantitative proteomics of collided ribosomes that EDF1 is a ZNF598-independent sensor of ribosome collisions. EDF1 recruits and stabilizes GIGYF2 at collisions to inhibit translation initiation in cis via 4EHP. The GIGYF2 axis acts independently of the ZNF598 axis, but each pathway’s output is more pronounced without the other. We propose that the widely conserved and highly abundant EDF1 monitors the transcriptome for excessive ribosome density, then triggers a GIGYF2-mediated response to locally and temporarily reduce ribosome loading. Only when collisions persist is translation abandoned to initiate ZNF598-dependent quality control. This tiered response to ribosome collisions would allow cells to dynamically tune translation rates while ensuring fidelity of the resulting protein products.

2020-07-14 | PXD020239 | Pride

Alternative polyadenylation of MeCP2: Influence of cis-acting elements and trans-acting factors.

Project description:The human MeCP2 gene encodes a ubiquitously expressed methyl CpG binding protein. Mutations in this gene cause a neurodevelopmental disorder called Rett Syndrome (RS). Mutations identified in the coding region of MeCP2 account for approximately 65% of all RS cases. However, 35% of all patients do not show mutations in the coding region of MeCP2, suggesting that mutations in non-coding regions likely exist that affect MeCP2 expression rather than protein function. The gene is unusual in that is has a >8.5 kb 3' untranslated region (3' UTR), and the size of the 3'UTR is differentially regulated in various tissues because of distinct polyadenylation signals. We have identified putative cis-acting auxiliary regulatory elements that play a role in alternative polyadenylation of MeCP2 using an in vivo polyadenylation reporter assay and in a luciferase assay. These cis-acting auxiliary elements are found both upstream and downstream of the core CPSF binding sites. Mutation of one of these cis-acting auxiliary elements, a G-rich element (GRS) significantly reduced MeCP2 polyadenylation efficiency in vivo. We further investigated what trans-acting factor(s) might be binding to this cis-acting element and found that hnRNP F protein binds specifically to the element. We next investigated the MeCP2 3' UTRs by performing quantitative real-time PCR; the data suggest that altered RNA stability is not a major factor in differential MeCP2 3' UTR usage. In sum, the mechanism(s) of regulated alternative 3'UTR usage of MeCP2 are complex, and insight into these mechanisms will aid our understanding of the factors that influence MeCP2 expression.

| S-EPMC4096559 | biostudies-literature

Sequential Regulation of Maternal mRNAs through a Conserved cis-Acting Element in Their 3' UTRs.

Project description:Maternal mRNAs synthesized during oogenesis initiate the development of future generations. Some maternal mRNAs are either somatic or germline determinants and must be translationally repressed until embryogenesis. However, the translational repressors themselves are temporally regulated. We used polar granule component (pgc), a Drosophila maternal mRNA, to ask how maternal transcripts are repressed while the regulatory landscape is shifting. pgc, a germline determinant, is translationally regulated throughout oogenesis. We find that different conserved RNA-binding proteins bind a 10-nt sequence in the 3' UTR of pgc mRNA to continuously repress translation at different stages of oogenesis. Pumilio binds to this sequence in undifferentiated and early-differentiating oocytes to block Pgc translation. After differentiation, Bruno levels increase, allowing Bruno to bind the same sequence and take over translational repression of pgc mRNA. We have identified a class of maternal mRNAs that are regulated similarly, including zelda, the activator of the zygotic genome.

| S-EPMC6328254 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data