Browse
Submit Data
Databases
API
Help

Dataset Information

14 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Myosin 1E interacts with synaptojanin-1 and dynamin and is involved in endocytosis.

ABSTRACT: Myosin 1E is one of two "long-tailed" human Class I myosins that contain an SH3 domain within the tail region. SH3 domains of yeast and amoeboid myosins I interact with activators of the Arp2/3 complex, an important regulator of actin polymerization. No binding partners for the SH3 domains of myosins I have been identified in higher eukaryotes. In the current study, we show that two proteins with prominent functions in endocytosis, synaptojanin-1 and dynamin, bind to the SH3 domain of human Myo1E. Myosin 1E co-localizes with clathrin- and dynamin-containing puncta at the plasma membrane and this co-localization requires an intact SH3 domain. Expression of Myo1E tail, which acts in a dominant-negative manner, inhibits endocytosis of transferrin. Our findings suggest that myosin 1E may contribute to receptor-mediated endocytosis.

SUBMITTER: Krendel M

PROVIDER: S-EPMC1861834 | biostudies-literature | 2007 Feb

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Myosin 1E interacts with synaptojanin-1 and dynamin and is involved in endocytosis.

Krendel Mira M Osterweil Emily K EK Mooseker Mark S MS

FEBS letters 20070118 4

Myosin 1E is one of two "long-tailed" human Class I myosins that contain an SH3 domain within the tail region. SH3 domains of yeast and amoeboid myosins I interact with activators of the Arp2/3 complex, an important regulator of actin polymerization. No binding partners for the SH3 domains of myosins I have been identified in higher eukaryotes. In the current study, we show that two proteins with prominent functions in endocytosis, synaptojanin-1 and dynamin, bind to the SH3 domain of human Myo1 ...[more]

PMID: 17257598

Similar Datasets

Myosin 1E coordinates actin assembly and cargo trafficking during clathrin-mediated endocytosis.

Project description:Myosin 1E (Myo1E) is recruited to sites of clathrin-mediated endocytosis coincident with a burst of actin assembly. The recruitment dynamics and lifetime of Myo1E are similar to those of tagged actin polymerization regulatory proteins. Like inhibition of actin assembly, depletion of Myo1E causes reduced transferrin endocytosis and a significant delay in transferrin trafficking to perinuclear compartments, demonstrating an integral role for Myo1E in these actin-mediated steps. Mistargeting of GFP-Myo1E or its src-homology 3 domain to mitochondria results in appearance of WIP, WIRE, N-WASP, and actin filaments at the mitochondria, providing evidence for Myo1E's role in actin assembly regulation. These results suggest for mammalian cells, similar to budding yeast, interdependence in the recruitment of type I myosins, WIP/WIRE, and N-WASP to endocytic sites for Arp2/3 complex activation to assemble F-actin as endocytic vesicles are being formed.

| S-EPMC3408416 | biostudies-literature

Myosin-1E interacts with FAK proline-rich region 1 to induce fibronectin-type matrix.

Project description:Focal adhesion kinase (FAK) is a nonreceptor tyrosine kinase involved in development and human disease, including cancer. It is currently thought that the four-point one, ezrin, radixin, moesin (FERM)-kinase domain linker, which contains autophosphorylation site tyrosine (Y) 397, is not required for in vivo FAK function until late midgestation. Here, we directly tested this hypothesis by generating mice with FAK Y397-to-phenylalanine (F) mutations in the germline. We found that Y397F embryos exhibited reduced mesodermal fibronectin (FN) and osteopontin expression and died during mesoderm development akin to FAK kinase-dead mice. We identified myosin-1E (MYO1E), an actin-dependent molecular motor, to interact directly with the FAK FERM-kinase linker and induce FAK kinase activity and Y397 phosphorylation. Active FAK in turn accumulated in the nucleus where it led to the expression of osteopontin and other FN-type matrix in both mouse embryonic fibroblasts and human melanoma. Our data support a model in which FAK Y397 autophosphorylation is required for FAK function in vivo and is positively regulated by MYO1E.

| S-EPMC5393228 | biostudies-literature

Human myosin 1e tail but not motor domain replaces fission yeast Myo1 domains to support myosin-I function during endocytosis.

Project description:In both unicellular and multicellular organisms, long-tailed class I myosins function in clathrin-mediated endocytosis. Myosin 1e (Myo1e) in vertebrates and Myo1 in fission yeast have similar domain organization, yet whether these proteins or their individual protein domains are functionally interchangeable remains unknown. In an effort to assess functional conservation of class I myosins, we tested whether human Myo1e could replace Myo1 in fission yeast Schizosaccharomyces pombe and found that it was unable to substitute for yeast Myo1. To determine if any individual protein domain is responsible for the inability of Myo1e to function in yeast, we created human-yeast myosin-I chimeras. By functionally testing these chimeric myosins in vivo, we concluded that the Myo1e motor domain is unable to function in yeast, even when combined with the yeast Myo1 tail and a full complement of yeast regulatory light chains. Conversely, the Myo1e tail, when attached to the yeast Myo1 motor domain, supports localization to endocytic actin patches and partially rescues the endocytosis defect in myo1? cells. Further dissection showed that both the TH1 and TH2-SH3 domains in the human Myo1e tail are required for localization and function of chimeric myosin-I at endocytic sites. Overall, this study provides insights into the role of individual myosin-I domains, expands the utility of fission yeast as a simple model system to study the effects of disease-associated MYO1E mutations, and supports a model of co-evolution between a myosin motor and its actin track.

| S-EPMC6924955 | biostudies-literature

Role of dynamin, synaptojanin, and endophilin in podocyte foot processes.

Project description:Podocytes are specialized cells that play an integral role in the renal glomerular filtration barrier via their foot processes. The foot processes form a highly organized structure, the disruption of which causes nephrotic syndrome. Interestingly, several similarities have been observed between mechanisms that govern podocyte organization and mechanisms that mediate neuronal synapse development. Dynamin, synaptojanin, and endophilin are functional partners in synaptic vesicle recycling via interconnected actions in clathrin-mediated endocytosis and actin dynamics in neurons. A role of dynamin in the maintenance of the kidney filtration barrier via an action on the actin cytoskeleton of podocytes was suggested. Here we used a conditional double-KO of dynamin 1 (Dnm1) and Dnm2 in mouse podocytes to confirm dynamin's role in podocyte foot process maintenance. In addition, we demonstrated that while synaptojanin 1 (Synj1) KO mice and endophilin 1 (Sh3gl2), endophilin 2 (Sh3gl1), and endophilin 3 (Sh3gl3) triple-KO mice had grossly normal embryonic development, these mutants failed to establish a normal filtration barrier and exhibited severe proteinuria due to abnormal podocyte foot process formation. These results strongly implicate a protein network that functions at the interface between endocytosis and actin at neuronal synapses in the formation and maintenance of the kidney glomerular filtration barrier.

| S-EPMC3533561 | biostudies-literature

Synaptojanin and Endophilin Mediate Neck Formation during Ultrafast Endocytosis.

Project description:Ultrafast endocytosis generates vesicles from the plasma membrane as quickly as 50 ms in hippocampal neurons following synaptic vesicle fusion. The molecular mechanism underlying the rapid maturation of these endocytic pits is not known. Here we demonstrate that synaptojanin-1, and its partner endophilin-A, function in ultrafast endocytosis. In the absence of synaptojanin or endophilin, the membrane is rapidly invaginated, but pits do not become constricted at the base. The 5-phosphatase activity of synaptojanin is involved in formation of the neck, but 4-phosphatase is not required. Nevertheless, these pits are eventually cleaved into vesicles; within a 30-s interval, synaptic endosomes form and are resolved by clathrin-mediated budding. Then synaptojanin and endophilin function at a second step to aid with the removal of clathrin coats from the regenerated vesicles. These data together suggest that synaptojanin and endophilin can mediate membrane remodeling on a millisecond timescale during ultrafast endocytosis.

| S-EPMC6086574 | biostudies-literature

Dynamin 1xA interacts with Endophilin A1 via its spliced long C-terminus for ultrafast endocytosis

Project description:Dynamin 1 mediates fission of endocytic synaptic vesicles in the brain and has two major splice variants, Dyn1xA and Dyn1xB, which are nearly identical apart from the extended C-terminal region of Dyn1xA. Despite a similar set of binding partners, only Dyn1xA is enriched at endocytic zones and accelerates vesicle fission during ultrafast endocytosis. Here, we report that Dyn1xA achieves this localization by preferentially binding to Endophilin A1 through a newly defined binding site within its long C-terminal tail extension. Endophilin A1 binds this site at higher affinity than the previously reported site, and the affinity is determined by amino acids within the Dyn1xA tail but outside the binding site. This interaction is regulated by the phosphorylation state of two serine residues specific to the Dyn1xA variant. Dyn1xA and Endophilin A1 colocalize in patches near the active zone, and mutations disrupting Endophilin A binding to the long tail cause Dyn1xA mislocalization and stalled endocytic pits on the plasma membrane during ultrafast endocytosis. Together, these data suggest that the specificity for ultrafast endocytosis is defined by the phosphorylation-regulated interaction of Endophilin A1 with the C-terminal extension of Dyn1xA.

| S-SCDT-10_1038-S44318-024-00145-X | biostudies-other

Disruption of Myosin 1e promotes podocyte injury.

Project description:Myosin 1e (Myo1e) is one of two Src homology 3 domain-containing "long-tailed" type I myosins in vertebrates, whose functions in health and disease are incompletely understood. Here, we demonstrate that Myo1e localizes to podocytes in the kidney. We generated Myo1e-knockout mice and found that they exhibit proteinuria, signs of chronic renal injury, and kidney inflammation. At the ultrastructural level, renal tissue from Myo1e-null mice demonstrates changes characteristic of glomerular disease, including a thickened and disorganized glomerular basement membrane and flattened podocyte foot processes. These observations suggest that Myo1e plays an important role in podocyte function and normal glomerular filtration.

| S-EPMC2615733 | biostudies-literature

Nodal-mediated epigenesis requires dynamin-mediated endocytosis.

Project description:Nodal proteins are diffusible morphogens that drive pattern formation via short-range feedback activation coupled to long-range Lefty-mediated inhibition. In the sea urchin embryo, specification of the secondary (oral-aboral) axis occurs via zygotic expression of nodal, which is localized to the prospective oral ectoderm at early blastula stage. In mid-blastula stage embryos treated with low micromolar nickel or zinc, nodal expression expands progressively beyond the confines of this localized domain to encompass the entire equatorial circumference of the embryo, producing radialized embryos lacking an oral-aboral axis. RNAseq analysis of embryos treated with nickel, zinc, or cadmium (which does not radialize embryos) showed that several genes involved in endocytosis were similarly perturbed by nickel and zinc but not cadmium. Inhibiting dynamin, a GTPase required for receptor-mediated endocytosis, phenocopies the effects of nickel and zinc, suggesting that dynamin-mediated endocytosis is required as a sink to limit the range of Nodal signaling.

| S-EPMC3079387 | biostudies-literature

Notch promotes dynamin-dependent endocytosis of nephrin.

Project description:Notch signaling in podocytes causes proteinuria and glomerulosclerosis in humans and rodents, but the underlying mechanism remains unknown. Here, we analyzed morphologic, molecular, and cellular events before the onset of proteinuria in newborn transgenic mice that express activated Notch in podocytes. Immunohistochemistry revealed a loss of the slit diaphragm protein nephrin exclusively in podocytes expressing activated Notch. Podocyte-specific deletion of Rbpj, which is essential for canonical Notch signaling, prevented this loss of nephrin. Overexpression of activated Notch decreased cell surface nephrin and increased cytoplasmic nephrin in transfected HEK293T cells; pharmacologic inhibition of dynamin, but not depletion of cholesterol, blocked these effects on nephrin, suggesting that Notch promotes dynamin-dependent, raft-independent endocytosis of nephrin. Supporting an association between Notch signaling and nephrin trafficking, electron microscopy revealed shortened podocyte foot processes and fewer slit diaphragms among the transgenic mice compared with controls. These data suggest that Notch signaling induces endocytosis of nephrin, thereby triggering the onset of proteinuria.

| S-EPMC3269920 | biostudies-literature

Transcriptomic Profiling of Myosin 1e WT and KO 4T1 Cell Pools

Project description:Myosin 1e may influnece the metastatic spread of breast cancer cells as determined using the MMT-PyMT mouse model deficient in myo1e, which demonstrated no lung metastases. Therefore, we used CRISPR to knock out Myosin 1e (myo1e) in the 4T1 breast cancer line to study the effect on the propensity to metastasize. The Myosin 1e (Myo1e) WT and KO 4T1 cell pools were generated by Synthego using gRNA sequence 'CUUCUUCAGGUUCUCUACAA'.

2023-12-18 | GSE202685 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data