Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Disruption of Myosin 1e promotes podocyte injury.

ABSTRACT: Myosin 1e (Myo1e) is one of two Src homology 3 domain-containing "long-tailed" type I myosins in vertebrates, whose functions in health and disease are incompletely understood. Here, we demonstrate that Myo1e localizes to podocytes in the kidney. We generated Myo1e-knockout mice and found that they exhibit proteinuria, signs of chronic renal injury, and kidney inflammation. At the ultrastructural level, renal tissue from Myo1e-null mice demonstrates changes characteristic of glomerular disease, including a thickened and disorganized glomerular basement membrane and flattened podocyte foot processes. These observations suggest that Myo1e plays an important role in podocyte function and normal glomerular filtration.

SUBMITTER: Krendel M

PROVIDER: S-EPMC2615733 | biostudies-literature | 2009 Jan

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Disruption of Myosin 1e promotes podocyte injury.

Krendel Mira M Kim Sangwon V SV Willinger Tim T Wang Tong T Kashgarian Michael M Flavell Richard A RA Mooseker Mark S MS

Journal of the American Society of Nephrology : JASN 20081112 1

Myosin 1e (Myo1e) is one of two Src homology 3 domain-containing "long-tailed" type I myosins in vertebrates, whose functions in health and disease are incompletely understood. Here, we demonstrate that Myo1e localizes to podocytes in the kidney. We generated Myo1e-knockout mice and found that they exhibit proteinuria, signs of chronic renal injury, and kidney inflammation. At the ultrastructural level, renal tissue from Myo1e-null mice demonstrates changes characteristic of glomerular disease, ...[more]

PMID: 19005011

Similar Datasets

ERK signaling promotes cell motility by inducing the localization of myosin 1E to lamellipodial tips.

Project description:Signaling by extracellular signal-regulated kinase (ERK) plays an essential role in the induction of cell motility, but the precise mechanism underlying such regulation has remained elusive. We recently identified SH3P2 as a negative regulator of cell motility whose function is inhibited by p90 ribosomal S6 kinase (RSK)-mediated phosphorylation downstream of ERK. We here show that myosin 1E (Myo1E) is a binding partner of SH3P2 and that the interaction of the two proteins in the cytosol prevents the localization of Myo1E to the plasma membrane. Serum-induced phosphorylation of SH3P2 at Ser(202) by RSK results in dissociation of Myo1E from SH3P2 in the cytosol and the subsequent localization of Myo1E to the tips of lamellipodia mediated by binding of its TH2 domain to F-actin. This translocation of Myo1E is essential for lamellipodium extension and consequent cell migration. The ERK signaling pathway thus promotes cell motility through regulation of the subcellular localization of Myo1E.

| S-EPMC4987290 | biostudies-literature

Myosin 1e promotes breast cancer malignancy by enhancing tumor cell proliferation and stimulating tumor cell de-differentiation.

Project description:Despite advancing therapies, thousands of women die every year of breast cancer. Myosins, actin-dependent molecular motors, are likely to contribute to tumor formation and metastasis via their effects on cell adhesion and migration and may provide promising new targets for cancer therapies. Using the MMTV-PyMT murine model of breast cancer, we identified Myosin 1e (MYO1E) as a novel tumor promoter. Tumor latency in mice lacking MYO1E was significantly increased, and tumors formed in the absence of MYO1E displayed unusual papillary morphology, with well-differentiated layers of epithelial cells covering fibrovascular cores, rather than solid sheets of tumor cells typically observed in this cancer model. These tumors were reminiscent of papillary breast cancer in humans that is typically non-invasive and often cured by tumor excision. MYO1E-null tumors exhibited decreased expression of the markers of cell proliferation, which was recapitulated in primary tumor cells derived from MYO1E-null mice. In agreement with our findings, meta-analysis of patient survival data indicated that MYO1E expression level was associated with reduced recurrence-free survival in basal-like breast cancer. Overall, our data suggests that MYO1E contributes to breast tumor malignancy and regulates the differentiation and proliferation state of breast tumor cells.

| S-EPMC5216807 | biostudies-literature

Augmenting podocyte injury promotes advanced diabetic kidney disease in Akita mice.

Project description:To determine if augmenting podocyte injury promotes the development of advanced diabetic nephropathy (DN), we created mice that expressed the enzyme cytosine deaminase (CD) specifically in podocytes of diabetic Akita mice (Akita-CD mice). In these mice, treatment with the prodrug 5-flucytosine (5-FC) causes podocyte injury as a result of conversion to the toxic metabolite 5-fluorouracil (5-FU). We found that treatment of 4-5 week old Akita mice with 5-FC for 5 days caused robust albuminuria at 16 and 20 weeks of age compared to 5-FC treated Akita controls, which do not express CD (Akita CTLs). By 20 weeks of age, there was a significant increase in mesangial expansion in Akita-CD mice compared to Akita CTLs, which was associated with a variable increase in glomerular basement membrane (GBM) width and interstitial fibrosis. At 20 weeks of age, podocyte number was similarly reduced in both groups of Akita mice, and was inversely correlated with the albuminuria and mesangial expansion. Thus, enhancing podocyte injury early in the disease process promotes the development of prominent mesangial expansion, interstitial fibrosis, increased GBM thickness and robust albuminuria. These data suggest that podocytes play a key role in the development of advanced features of diabetic kidney disease.

| S-EPMC3985087 | biostudies-literature

Transcriptomic Profiling of Myosin 1e WT and KO 4T1 Cell Pools

Project description:Myosin 1e may influnece the metastatic spread of breast cancer cells as determined using the MMT-PyMT mouse model deficient in myo1e, which demonstrated no lung metastases. Therefore, we used CRISPR to knock out Myosin 1e (myo1e) in the 4T1 breast cancer line to study the effect on the propensity to metastasize. The Myosin 1e (Myo1e) WT and KO 4T1 cell pools were generated by Synthego using gRNA sequence 'CUUCUUCAGGUUCUCUACAA'.

2023-12-18 | GSE202685 | GEO

MicroRNA-27a promotes podocyte injury via PPAR?-mediated ?-catenin activation in diabetic nephropathy.

Project description:Podocyte injury has a pivotal role in the pathogenesis of diabetic nephropathy (DN). MicroRNA-27a (miR-27a), peroxisome proliferator-activated receptor ? (PPAR?) and ?-catenin pathways have been involved in the pathogenesis of DN. Herein, we asked whether miR-27a mediates podocyte injury through PPAR?/?-catenin signaling in DN. The functional relevance of miR-27a, PPAR? and ?-catenin were investigated in cultured podocytes and glomeruli of diabetic rats and patients using in vitro and in vivo approaches. Podocyte injury was assessed by migration, invasion and apoptosis assay. Biological parameters were analyzed using enzyme-linked immunosorbent assay. We found that high glucose stimulated miR-27a expression, which, by negatively targeting PPAR?, activated ?-catenin signaling as evidenced by upregulation of ?-catenin target genes, snail1 and ?-smooth muscle actin (?-SMA) and downregulation of podocyte-specific markers podocin and synaptopodin. These changes caused podocyte injury as demonstrated by increased podocyte mesenchymal transition, disrupted podocyte architectural integrity and increased podocyte apoptosis. Furthermore, we provide evidence that miR-27a contributed to unfavorable renal function and increased podocyte injury in diabetic rats. Notably, miR-27a exhibited clinical and biological relevance as it was linked to elevated serum creatinine, proteinuria and reduced creatinine clearance rate. In addition, miR-27a upregulation and activation of PPAR?/?-catenin signaling were verified in renal biopsy samples from DN patients. We propose a novel role of the miR-27a/PPAR?/?-catenin axis in fostering the progression toward more deteriorated podocyte injury in DN. Targeting miR-27a could be a potential therapeutic approach for DN.

| S-EPMC5386567 | biostudies-literature

Angiotensin II promotes podocyte injury by activating Arf6-Erk1/2-Nox4 signaling pathway.

Project description:Angiotensin II (Ang II) is a key contributor to glomerular disease by predominantly resulting in podocyte injury, whereas the underlying molecular mechanisms has not been fully understood. This study aimed to investigate if and how ADP-ribosylation factor 6 (Arf6), a small GTP-binding protein, involves Ang II-induced cellular injury in cultured human podocytes. Cellular injury was evaluated with caspase 3 activity, reactive oxygen species (ROS) level and TUNEL assay. Arf6 activity was measured using an Arf6-GTP Pull-Down Assay. Ang II significantly enhanced Arf6 expressions accompanied by increase of Arf6-GTP. The TUNEL-positive cells as well as activated caspase 3, NADPH oxidase 4 protein (Nox4) and ROS levels were dramatically increased in Ang II-treated podocytes, which was prevented by secinH3, an Arf6 activity inhibitor. Induction of ROS by Ang II was inhibited in podocytes with Nox4 knockdown. Ang II-induced elevation of Nox4 and ROS was prevented by Arf6 knockdown. Phpspho-Erk1/2Thr202/Tyr204 levels were upregulated remarkably following Ang II treatment, and Erk inhibitor LY3214996 significantly downregulated Nox4 expression. In addition, Ang II decreased CD2AP expression. Overexpression of CD2AP prevented Ang II-induced upregulation of Arf6-GTP. Our data demonstrated that Ang II promotes ROS production and podocytes injury through activation of Arf6-Erk1/2-Nox4 signaling. We also provided evidence that Ang II activates Arf6 by degradation of CD2AP.

| S-EPMC7051060 | biostudies-literature

MAD2B promotes podocyte injury through regulating Numb-dependent Notch 1 pathway in diabetic nephropathy.

Project description:Rationale: Recent studies have demonstrated that the loss of podocyte is a critical event in diabetic nephropathy (DN). Previously, our group have found that the mitotic arrest deficient protein MAD2B was involved in high glucose (HG)-induced podocyte injury by regulating APC/C activity. However, the exact mechanism of MAD2B implicated in podocyte injury is still lacking. Methods: The experiments were conducted by using kidney tissues from streptozotocin (STZ) induced diabetic mice with or without podocyte-specific deletion of MAD2B and the cultured podocytes exposed to different treatments. Glomerular pathological injury was evaluated by periodic acid-Schiff staining and transmission electron microscopy. The endogenous interaction between MAD2B and Numb was discovered by yeast two-hybrid analysis and co-immunoprecipitation assay. The expressions of MAD2B, Numb and related pathway were detected by western blot, immunochemistry and immunofluorescence. Results: The present study revealed that MAD2B was upregulated in diabetic glomeruli and cultured podocytes under hyperglycemic conditions. Podocyte-specific deletion of MAD2B alleviated podocyte injury and renal function deterioration in mice of diabetic nephropathy. Afterwards, MAD2B was found to interact with Numb, which was downregulated in diabetic glomeruli and HG-stimulated cultured podocytes. Interestingly, MAD2B genetic deletion could partly reverse the decline of Numb in podocytes exposed to HG and in diabetic mice, and the expressions of Numb downstream molecules such as NICD and Hes-1 were decreased accordingly. In addition, overexpression of Numb ameliorated HG-induced podocyte injury. Conclusions: The present findings suggest that upregulated MAD2B expression contributes to Numb depletion and activation of Notch 1 signaling pathway, which ultimately leads to podocyte injury during DN progression.

| S-EPMC8935242 | biostudies-literature

Myosin 1E coordinates actin assembly and cargo trafficking during clathrin-mediated endocytosis.

Project description:Myosin 1E (Myo1E) is recruited to sites of clathrin-mediated endocytosis coincident with a burst of actin assembly. The recruitment dynamics and lifetime of Myo1E are similar to those of tagged actin polymerization regulatory proteins. Like inhibition of actin assembly, depletion of Myo1E causes reduced transferrin endocytosis and a significant delay in transferrin trafficking to perinuclear compartments, demonstrating an integral role for Myo1E in these actin-mediated steps. Mistargeting of GFP-Myo1E or its src-homology 3 domain to mitochondria results in appearance of WIP, WIRE, N-WASP, and actin filaments at the mitochondria, providing evidence for Myo1E's role in actin assembly regulation. These results suggest for mammalian cells, similar to budding yeast, interdependence in the recruitment of type I myosins, WIP/WIRE, and N-WASP to endocytic sites for Arp2/3 complex activation to assemble F-actin as endocytic vesicles are being formed.

| S-EPMC3408416 | biostudies-literature

A role for myosin 1e in cortical granule exocytosis in Xenopus oocytes.

Project description:Xenopus oocytes undergo dynamic structural changes during maturation and fertilization. Among these, cortical granule exocytosis and compensatory endocytosis provide effective models to study membrane trafficking. This study documents an important role for myosin 1e in cortical granule exocytosis. Myosin 1e is expressed at the earliest stage that cortical granule exocytosis can be detected in oocytes. Prior to exocytosis, myosin 1e relocates to the surface of cortical granules. Overexpression of myosin 1e augments the kinetics of cortical granule exocytosis, whereas tail-derived fragments of myosin 1e inhibit this secretory event (but not constitutive exocytosis). Finally, intracellular injection of myosin 1e antibody inhibits cortical granule exocytosis. Further experiments identified cysteine string proteins as interacting partners for myosin 1e. As constituents of the membrane of cortical granules, cysteine string proteins are also essential for cortical granule exocytosis. Future investigation of the link between myosin 1e and cysteine string proteins should help to clarify basic mechanisms of regulated exocytosis.

| S-EPMC2820112 | biostudies-literature

Podocyte injury damages other podocytes.

Project description:Loss of podocytes promotes glomerulosclerosis, but whether this results from a continued primary insult or a secondary mechanism triggered by the initial loss of podocytes is unknown. We generated chimeric mice in which only a subpopulation of podocytes expressed hCD25, which is the receptor for the immunotoxin LMB2. In addition, genetic labeling of hCD25-negative cells with human placental alkaline phosphatase allowed the study of these two distinct podocyte populations. Administration of LMB2 did not cause podocyte injury in hCD25-negative control mice. In contrast, LMB2 severely damaged or sloughed off the subpopulation of hCD25-positive podocytes within the chimeric glomeruli. Moreover, hCD25-negative podocytes, which were immune to the initial toxin injury, developed injury as early as 4 d after LMB2 injection, evidenced by foot process effacement, upregulation of desmin, and downregulation of nephrin, podocin, and podocalyxin. Furthermore, the magnitude of secondary injury correlated with the magnitude of primary injury, supporting the concept of an amplified cascade of podocyte injury. In conclusion, podocyte damage can propagate injury by triggering secondary damage of "remnant" intact podocytes, even when the primary insult is short-lived. This transmission of podocyte injury may form a vicious cycle leading to accelerated podocyte deterioration and glomerulosclerosis.

| S-EPMC3137575 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data