Dataset Information

Prospective identification of enteroviruses involved in meningitis in 2006 through direct genotyping in cerebrospinal fluid.

ABSTRACT: Enterovirus infections were investigated with special emphasis on performing rapid molecular identification of enterovirus serotypes responsible for aseptic meningitis directly in cerebrospinal fluid (CSF). Enterovirus genotyping was carried out directly with specimens tested for the diagnostic procedure, using two seminested PCR assays designed to amplify the complete and partial gene sequences encoding the VP1 and VP4/VP2 capsid proteins, respectively. The method was used for identifying the enterovirus serotypes involved in meningitis in 45 patients admitted in 2005. Enterovirus genotyping was achieved in 98% of the patients studied, and we obtained evidence of 10 of the most frequent serotypes identified earlier by genotyping of virus isolates. The method was applied for the prospective investigation of 54 patients with meningitis admitted consecutively in 2006. The enterovirus serotypes involved were identified with the cerebrospinal fluid (CSF) of 52 patients (96%) and comprised 13 serotypes within the human enterovirus B species and 1 within the human enterovirus A species. The three most common serotypes were echovirus 13 (E13; 24%), E6 (23%), and coxsackievirus B5 (11.5%), a pattern different from that observed in 2005. Genotyping of virus isolates was also performed in 35 patients in 2006 (meningitis, n = 31; other diseases, n = 4). By comparison, direct genotyping in CSF yielded a more complete pattern of enterovirus serotypes, thereby allowing the detection of rare serotypes: three less common serotypes (CB2, E21, and E27) were not detected by indirect genotyping alone. The study shows the feasibility of prospective enterovirus genotyping within 1 week in a laboratory setting.

SUBMITTER: Mirand A

PROVIDER: S-EPMC2224282 | biostudies-literature | 2008 Jan

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Prospective identification of enteroviruses involved in meningitis in 2006 through direct genotyping in cerebrospinal fluid.

Mirand Audrey A Henquell Cécile C Archimbaud Christine C Chambon Martine M Charbonne Françoise F Peigue-Lafeuille Hélène H Bailly Jean-Luc JL

Journal of clinical microbiology 20071031 1

Enterovirus infections were investigated with special emphasis on performing rapid molecular identification of enterovirus serotypes responsible for aseptic meningitis directly in cerebrospinal fluid (CSF). Enterovirus genotyping was carried out directly with specimens tested for the diagnostic procedure, using two seminested PCR assays designed to amplify the complete and partial gene sequences encoding the VP1 and VP4/VP2 capsid proteins, respectively. The method was used for identifying the e ...[more]

PMID: 17977989

Similar Datasets

Project description:BackgroundCryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons.MethodsThe CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software.ResultsThe 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed.ConclusionsThe metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.

Project description:Differential diagnosis of bacterial meningitis (BM) and viral meningitis (VM) is a critical clinical challenge, as the early and accurate identification of the causative agent determines the appropriate treatment regimen and markedly improves patient outcomes. Clinical and experimental studies have demonstrated that the pathogen and the host immune response contribute to mortality and neurological sequelae. As BM is associated with the activation of an inflammatory cascade, the patterns of pro- and anti-inflammatory cytokines/chemokines (CTs/CKs) present in the cerebrospinal fluid (CSF) in response to the immune assault may be useful as sensitive markers for differentiating BM from VM. In the present study, the ability of CTs/CKs in the CSF to differentiate between BM and VM was investigated. For this, biochemical markers and CT/CK profiles were analysed in 145 CSF samples, divided into three groups: BM (n=61), VM (n=58) and the control group (C; n=26) comprising patients with meningism. The CSF concentrations of monocyte chemoattractant protein-1, interleukin (IL)-8, IL-1β, IL-6, macrophage inflammatory protein-1α (MIP-1α), epithelial-neutrophil activating peptide, IL-10, tumour necrosis factor-α (TNF-α), proteins and white blood cells were significantly higher and the CSF glucose level was significantly lower in the BM group compared with the VM and C groups (P<0.01). Correlation analysis identified 28 significant correlations between various CTs/CKs in the BM group (P<0.01), with the strongest positive correlations being for TNF-α/IL-6 (r=0.75), TNF-α/MIP-1α (r=0.69), TNF-α/IL-1β (r=0.64) and IL-1β/MIP-1α (r=0.64). To identify the optimum CT/CK patterns for predicting and classifying BM and VM, a dataset of 119 BM and VM samples was divided into training (n=90) and testing (n=29) subsets for use as input for a Random Forest (RF) machine learning algorithm. For the 29 test samples (15 BM and 14 VM), the RF algorithm correctly classified 28 samples, with 92% sensitivity and 93% specificity. The results show that the patterns of CT/CK levels in the CSF can be used to aid discrimination of BM and VM.

Dataset Information

Prospective identification of enteroviruses involved in meningitis in 2006 through direct genotyping in cerebrospinal fluid.

Publications

Prospective identification of enteroviruses involved in meningitis in 2006 through direct genotyping in cerebrospinal fluid.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets