S-EPMC3022951 - Quantitative T2* imaging of metastatic human breast cancer to brain in the nude rat at 3 T. - OmicsDI

Unknown

Dataset Information

Quantitative T2* imaging of metastatic human breast cancer to brain in the nude rat at 3 T.

ABSTRACT: This study uses quantitative T(2)* imaging to track ferumoxides--protamine sulfate (FEPro)-labeled MDA-MB-231BR-Luc (231BRL) human breast cancer cells that metastasize to the nude rat brain. Four cohorts of nude rats were injected intracardially with FEPro-labeled, unlabeled or tumor necrosis factor-related apoptosis-inducing ligand(TRAIL)-treated (to induce apoptosis) 231BRL cells, or saline, in order to develop metastatic breast cancer in the brain. The heads of the rats were imaged serially over 3-4 weeks using gradient multi-echo and turbo spin-echo pulse sequences at 3 T with a solenoid receive-only 4-cm-diameter coil. Quantitative T(2)* maps of the whole brain were obtained by the application of single-exponential fitting to the signal intensity of T(2)* images, and the distribution of T(2)* values in brain voxels was calculated. MRI findings were correlated with Prussian blue staining and immunohistochemical staining for iron in breast cancer and macrophages. Quantitative analysis of T(2)* from brain voxels demonstrated a significant shift to lower values following the intracardiac injection of FEPro-labeled 231BRL cells, relative to animals receiving unlabeled cells, apoptotic cells or saline. Quartile analysis based on the T(2)* distribution obtained from brain voxels demonstrated significant differences (p?

SUBMITTER: Song HT

PROVIDER: S-EPMC3022951 | biostudies-literature | 2011 Apr

REPOSITORIES: biostudies-literature

altmetric image

Publications

Quantitative T2* imaging of metastatic human breast cancer to brain in the nude rat at 3 T.

Song Ho-Taek HT Jordan Elaine K EK Lewis Bobbi K BK Gold Eric E Liu Wei W Frank Joseph A JA

NMR in biomedicine 20101015 3

This study uses quantitative T(2)* imaging to track ferumoxides--protamine sulfate (FEPro)-labeled MDA-MB-231BR-Luc (231BRL) human breast cancer cells that metastasize to the nude rat brain. Four cohorts of nude rats were injected intracardially with FEPro-labeled, unlabeled or tumor necrosis factor-related apoptosis-inducing ligand(TRAIL)-treated (to induce apoptosis) 231BRL cells, or saline, in order to develop metastatic breast cancer in the brain. The heads of the rats were imaged serially o ...[more]

Similar Datasets

Project description:BackgroundEstablishing a large rodent model of brain metastasis that can be monitored using clinically relevant magnetic resonance imaging (MRI) techniques is challenging. Non-invasive imaging of brain metastasis in mice usually requires high field strength MR units and long imaging acquisition times. Using the brain seeking MDA-MB-231BR transfected with luciferase gene, a metastatic breast cancer brain tumor model was investigated in the nude rat. Serial MRI and bioluminescence imaging (BLI) was performed and findings were correlated with histology. Results demonstrated the utility of multimodality imaging in identifying unexpected sights of metastasis and monitoring the progression of disease in the nude rat.MethodsBrain seeking breast cancer cells MDA-MB-231BR transfected with firefly luciferase (231BRL) were labeled with ferumoxides-protamine sulfate (FEPro) and 1-3 x 106 cells were intracardiac (IC) injected. MRI and BLI were performed up to 4 weeks to monitor the early breast cancer cell infiltration into the brain and formation of metastases. Rats were euthanized at different time points and the imaging findings were correlated with histological analysis to validate the presence of metastases in tissues.ResultsEarly metastasis of the FEPro labeled 231BRL were demonstrated on T2*-weighted MRI and BLI within 1 week post IC injection of cells. Micro-metastatic tumors were detected in the brain on T2-weighted MRI as early as 2 weeks post-injection in greater than 85% of rats. Unexpected skeletal metastases from the 231BRL cells were demonstrated and validated by multimodal imaging. Brain metastases were clearly visible on T2 weighted MRI by 3-4 weeks post infusion of 231BRL cells, however BLI did not demonstrate photon flux activity originating from the brain in all animals due to scattering of the photons from tumors.ConclusionA model of metastatic breast cancer in the nude rat was successfully developed and evaluated using multimodal imaging including MRI and BLI providing the ability to study the temporal and spatial distribution of metastases in the brain and skeleton.

Project description:Background: Metastases to the brain from breast cancer have a high mortality. Basal-like and HER2 positive breast cancers appear to have a high propensity to spread to the brain. The mechanisms that allow cells to colonise the brain are unclear. Methods: We have analysed matched and unpaired samples of breast cancer and brain metastases using morphology, immunophenotype and expression profiling and validated the data using in vitro cell culturing models and in vivo mice model. Results: Most of the brain metastases were triple negative and had a basal-like phenotype. Metastatic cells to the brain over-expressed HER3 compared to primaries and showed evidence of higher activation of the MAPK pathways. Inhibition using anti-neuregulin antibody, Herceptin and Lapatinib reduced tumour growth in vitro and in vivo. Conclusions: The data demonstrate activation of neuregulin-HER3 pathway in brain metastases from breast cancer and suggest that even in absence of HER2 amplification (as with triple negative and basal cancers), anti-epidermal growth factor receptor family inhibitors may have a role in treating these patients. An initial set of 29 matched pairs of primary breast cancer and their brain metastases and 22 unmatched brain metastases of from breast cancer was were available as formalin fixed-paraffin embedded (FFPE) tumor blocks. A second set of validation samples comprisinged of 10 matched pairs of primary breast cancer and their corresponding brain metastases and a further 11 non-breast metastatic brain cancers tumours fromn non-breast sites (one melanoma, six lung adenocarcinomas, one prostate carcinoma, one colon carcinoma and two renal cell carcinomas was also studied. After filtering DASL data on the first set of samples, 15/29 matched pairs and 22/22 unmatched metastases remained available for analysis for the initial set. In the second set all samples were analysed. RNA extraction and Real-Time RT-PCR Three 5μm thick FFPE sections of clinical samples, parental cell line MB-MDA-231 cell line (fixed in paraformoldehyde and embedded in paraffin) and intracranial mouse tumours were cut and de-waxed in two lots of xylene and two lots of 100% ethanol, 10 minutes each. RNA was extracted using the High Pure RNA Paraffin Kit® (Roche Applied Science, Mannheim, Germany) according to the manufacturer’s protocol. RNA was quantified using the NanoDrop® ND-1000 (NanoDrop Technologies, DE, USA). RT-PCR for HER3 and housekeeping genes GAPDH and RPL13a was carried out using the Rotor-gene system (Corbett Life Science, Australia). Complementary DNA (cDNA) was synthesized from 240ng of total RNA using oligodT16 primers and the SuperScriptTM III Reverse Transcriptase kit (Invitrogen, Carsbald, CA, USA). A standard curve for gene expression of HER3 and GAPDH and RPL13a was constructed using total RNA from a human breast cancer cell line (SKBR-3). Replicates of 10-fold dilutions of RNA in water were made to give 3 different calibrators, each with a known amount of SKBR-3 RNA for which arbitrary copy number were given. The PCR conditions were: 50°C for 2 minutes, 95°C for 2 minutes, followed by 40 cycles with the following profile: denaturation at 95°C for 20 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 20 seconds. Flourescent incorporation was acquired in the green channel during the 72°C incubations. Intron spanning primer sequences were: GAPDH (5’CTGCACCACCAACTGCTTAG3’, 5’GTCTTCTGGGTGGCA GTGAT3’), RPL13a (5’GTTGGTGTTCATCCGTTG3’, 5’GTACGCTGTGAAGCATCAA3’), HER3 (5’TGGTTCATGGGCATGTATCC3’, 5’CTAGACCTAAGACTTGGAGC3’). DASL gene expression profilingGene expression profiling was performed using the DASL assay (cDNA-mediated annealing, selection extension and ligation, Illumina Inc., California, USA) interrogating the DASL Cancer Panel that contained 512 cancer related genes. The first and second sets of samples were analyzed in two independent experiments. Tumours arising from the animal experiment were analyzed in conjunction with the second set of clinical samples. All protocols were as specified by Illumina Inc. Briefly, RNA (250ng) was converted to cDNA through a reverse transcription reaction with biotinylated oligo-d(T)18 and random nonamers. Oligonucleotides (three unique pairs for each of the 512 genes) were annealed to the biotinylated cDNA, the duplexes were bound to streptavidin conjugated paramagnetic particles to remove non-hybridized oligos. The annealed oligos were then extended and ligated (to incorporate an address sequence and primer site) to generate amplifiable products. These products were subjected to PCR amplification using fluorescently labeled (Cy3 and Cy5) primers. The labeled PCR products were hybridized to a Sentrix array or Beadchip. Following hybridization, the arrays were scanned with a BeadArray Reader (Illumina) and data was extracted using BeadStudio software (Illumina). Samples exhibiting a median hybridization intensity across all probes of <600 (background corrected) were excluded from analysis. Probes with a BeadStudio detection score greater than 0.99 in more than 15 conditions were included. Array data transformation and normalization (per chip normalized to 50th percentile and per gene normalized to median) was done in Genespring® version 7.0 software (Agilent Technologies, Santa Clara, USA). Hierarchical clustering was performed using: Similarity measure; Pearson Correlation and clustering algorithm; Average Linkage. Genes differentially expressed between primary tumors and brain metastases were identified using analysis of variance (ANOVA, p<0.01) or parametric test, variances not assumed equal (Welch t-test, p < 0.005). Up and down regulation was considered for normalized data values that were greater or less than a factor of 2 fold for the conditions compared.

Project description:Background: Metastases to the brain from breast cancer have a high mortality. Basal-like and HER2 positive breast cancers appear to have a high propensity to spread to the brain. The mechanisms that allow cells to colonise the brain are unclear. Methods: We have analysed matched and unpaired samples of breast cancer and brain metastases using morphology, immunophenotype and expression profiling and validated the data using in vitro cell culturing models and in vivo mice model. Results: Most of the brain metastases were triple negative and had a basal-like phenotype. Metastatic cells to the brain over-expressed HER3 compared to primaries and showed evidence of higher activation of the MAPK pathways. Inhibition using anti-neuregulin antibody, Herceptin and Lapatinib reduced tumour growth in vitro and in vivo. Conclusions: The data demonstrate activation of neuregulin-HER3 pathway in brain metastases from breast cancer and suggest that even in absence of HER2 amplification (as with triple negative and basal cancers), anti-epidermal growth factor receptor family inhibitors may have a role in treating these patients An initial set of 29 matched pairs of primary breast cancer and their brain metastases and 22 unmatched brain metastases of from breast cancer was were available as formalin fixed-paraffin embedded (FFPE) tumor blocks. A second set of validation samples comprisinged of 10 matched pairs of primary breast cancer and their corresponding brain metastases and a further 11 non-breast metastatic brain cancers tumours fromn non-breast sites (one melanoma, six lung adenocarcinomas, one prostate carcinoma, one colon carcinoma and two renal cell carcinomas was also studied. After filtering DASL data on the first set of samples, 15/29 matched pairs and 22/22 unmatched metastases remained available for analysis for the initial set. In the second set all samples were analysed. RNA extraction and Real-Time RT-PCR Three 5μm thick FFPE sections of clinical samples, parental cell line MB-MDA-231 cell line (fixed in paraformoldehyde and embedded in paraffin) and intracranial mouse tumours were cut and de-waxed in two lots of xylene and two lots of 100% ethanol, 10 minutes each. RNA was extracted using the High Pure RNA Paraffin Kit® (Roche Applied Science, Mannheim, Germany) according to the manufacturer’s protocol. RNA was quantified using the NanoDrop® ND-1000 (NanoDrop Technologies, DE, USA). RT-PCR for HER3 and housekeeping genes GAPDH and RPL13a was carried out using the Rotor-gene system (Corbett Life Science, Australia). Complementary DNA (cDNA) was synthesized from 240ng of total RNA using oligodT16 primers and the SuperScriptTM III Reverse Transcriptase kit (Invitrogen, Carsbald, CA, USA). A standard curve for gene expression of HER3 and GAPDH and RPL13a was constructed using total RNA from a human breast cancer cell line (SKBR-3). Replicates of 10-fold dilutions of RNA in water were made to give 3 different calibrators, each with a known amount of SKBR-3 RNA for which arbitrary copy number were given. The PCR conditions were: 50°C for 2 minutes, 95°C for 2 minutes, followed by 40 cycles with the following profile: denaturation at 95°C for 20 seconds, annealing at 60°C for 15 seconds, extension at 72°C for 20 seconds. Flourescent incorporation was acquired in the green channel during the 72°C incubations. Intron spanning primer sequences were: GAPDH (5’CTGCACCACCAACTGCTTAG3’, 5’GTCTTCTGGGTGGCA GTGAT3’), RPL13a (5’GTTGGTGTTCATCCGTTG3’, 5’GTACGCTGTGAAGCATCAA3’), HER3 (5’TGGTTCATGGGCATGTATCC3’, 5’CTAGACCTAAGACTTGGAGC3’). DASL gene expression profilingGene expression profiling was performed using the DASL assay (cDNA-mediated annealing, selection extension and ligation, Illumina Inc., California, USA) interrogating the DASL Cancer Panel that contained 512 cancer related genes. The first and second sets of samples were analyzed in two independent experiments. Tumours arising from the animal experiment were analyzed in conjunction with the second set of clinical samples. All protocols were as specified by Illumina Inc. Briefly, RNA (250ng) was converted to cDNA through a reverse transcription reaction with biotinylated oligo-d(T)18 and random nonamers. Oligonucleotides (three unique pairs for each of the 512 genes) were annealed to the biotinylated cDNA, the duplexes were bound to streptavidin conjugated paramagnetic particles to remove non-hybridized oligos. The annealed oligos were then extended and ligated (to incorporate an address sequence and primer site) to generate amplifiable products. These products were subjected to PCR amplification using fluorescently labeled (Cy3 and Cy5) primers. The labeled PCR products were hybridized to a Sentrix array or Beadchip. Following hybridization, the arrays were scanned with a BeadArray Reader (Illumina) and data was extracted using BeadStudio software (Illumina). Samples exhibiting a median hybridization intensity across all probes of <600 (background corrected) were excluded from analysis. Probes with a BeadStudio detection score greater than 0.99 in more than 15 conditions were included. Array data transformation and normalization (per chip normalized to 50th percentile and per gene normalized to median) was done in Genespring® version 7.0 software (Agilent Technologies, Santa Clara, USA). Hierarchical clustering was performed using: Similarity measure; Pearson Correlation and clustering algorithm; Average Linkage. Genes differentially expressed between primary tumors and brain metastases were identified using analysis of variance (ANOVA, p<0.01) or parametric test, variances not assumed equal (Welch t-test, p < 0.005). Up and down regulation was considered for normalized data values that were greater or less than a factor of 2 fold for the conditions compared.

Project description:Background: Metastases to the brain from breast cancer have a high mortality. Basal-like and HER2 positive breast cancers appear to have a high propensity to spread to the brain. The mechanisms that allow cells to colonise the brain are unclear. Methods: We have analysed matched and unpaired samples of breast cancer and brain metastases using morphology, immunophenotype and expression profiling and validated the data using in vitro cell culturing models and in vivo mice model. Results: Most of the brain metastases were triple negative and had a basal-like phenotype. Metastatic cells to the brain over-expressed HER3 compared to primaries and showed evidence of higher activation of the MAPK pathways. Inhibition using anti-neuregulin antibody, Herceptin and Lapatinib reduced tumour growth in vitro and in vivo. Conclusions: The data demonstrate activation of neuregulin-HER3 pathway in brain metastases from breast cancer and suggest that even in absence of HER2 amplification (as with triple negative and basal cancers), anti-epidermal growth factor receptor family inhibitors may have a role in treating these patients An initial set of 29 matched pairs of primary breast cancer and their brain metastases and 22 unmatched brain metastases of from breast cancer was were available as formalin fixed-paraffin embedded (FFPE) tumor blocks. A second set of validation samples comprisinged of 10 matched pairs of primary breast cancer and their corresponding brain metastases and a further 11 non-breast metastatic brain cancers tumours fromn non-breast sites (one melanoma, six lung adenocarcinomas, one prostate carcinoma, one colon carcinoma and two renal cell carcinomas was also studied. After filtering DASL data on the first set of samples, 15/29 matched pairs and 22/22 unmatched metastases remained available for analysis for the initial set. In the second set all samples were analysed. RNA extraction and Real-Time RT-PCR Three 5Î¼m thick FFPE sections of clinical samples, parental cell line MB-MDA-231 cell line (fixed in paraformoldehyde and embedded in paraffin) and intracranial mouse tumours were cut and de-waxed in two lots of xylene and two lots of 100% ethanol, 10 minutes each. RNA was extracted using the High Pure RNA Paraffin KitÂ® (Roche Applied Science, Mannheim, Germany) according to the manufacturerâs protocol. RNA was quantified using the NanoDropÂ® ND-1000 (NanoDrop Technologies, DE, USA). RT-PCR for HER3 and housekeeping genes GAPDH and RPL13a was carried out using the Rotor-gene system (Corbett Life Science, Australia). Complementary DNA (cDNA) was synthesized from 240ng of total RNA using oligodT16 primers and the SuperScriptTM III Reverse Transcriptase kit (Invitrogen, Carsbald, CA, USA). A standard curve for gene expression of HER3 and GAPDH and RPL13a was constructed using total RNA from a human breast cancer cell line (SKBR-3). Replicates of 10-fold dilutions of RNA in water were made to give 3 different calibrators, each with a known amount of SKBR-3 RNA for which arbitrary copy number were given. The PCR conditions were: 50Â°C for 2 minutes, 95Â°C for 2 minutes, followed by 40 cycles with the following profile: denaturation at 95Â°C for 20 seconds, annealing at 60Â°C for 15 seconds, extension at 72Â°C for 20 seconds. Flourescent incorporation was acquired in the green channel during the 72Â°C incubations. Intron spanning primer sequences were: GAPDH (5âCTGCACCACCAACTGCTTAG3â, 5âGTCTTCTGGGTGGCA GTGAT3â), RPL13a (5âGTTGGTGTTCATCCGTTG3â, 5âGTACGCTGTGAAGCATCAA3â), HER3 (5âTGGTTCATGGGCATGTATCC3â, 5âCTAGACCTAAGACTTGGAGC3â). DASL gene expression profilingGene expression profiling was performed using the DASL assay (cDNA-mediated annealing, selection extension and ligation, Illumina Inc., California, USA) interrogating the DASL Cancer Panel that contained 512 cancer related genes. The first and second sets of samples were analyzed in two independent experiments. Tumours arising from the animal experiment were analyzed in conjunction with the second set of clinical samples. All protocols were as specified by Illumina Inc. Briefly, RNA (250ng) was converted to cDNA through a reverse transcription reaction with biotinylated oligo-d(T)18 and random nonamers. Oligonucleotides (three unique pairs for each of the 512 genes) were annealed to the biotinylated cDNA, the duplexes were bound to streptavidin conjugated paramagnetic particles to remove non-hybridized oligos. The annealed oligos were then extended and ligated (to incorporate an address sequence and primer site) to generate amplifiable products. These products were subjected to PCR amplification using fluorescently labeled (Cy3 and Cy5) primers. The labeled PCR products were hybridized to a Sentrix array or Beadchip. Following hybridization, the arrays were scanned with a BeadArray Reader (Illumina) and data was extracted using BeadStudio software (Illumina). Samples exhibiting a median hybridization intensity across all probes of <600 (background corrected) were excluded from analysis. Probes with a BeadStudio detection score greater than 0.99 in more than 15 conditions were included. Array data transformation and normalization (per chip normalized to 50th percentile and per gene normalized to median) was done in GenespringÂ® version 7.0 software (Agilent Technologies, Santa Clara, USA). Hierarchical clustering was performed using: Similarity measure; Pearson Correlation and clustering algorithm; Average Linkage. Genes differentially expressed between primary tumors and brain metastases were identified using analysis of variance (ANOVA, p<0.01) or parametric test, variances not assumed equal (Welch t-test, p < 0.005). Up and down regulation was considered for normalized data values that were greater or less than a factor of 2 fold for the conditions compared.