The Conformations of 17?-Estradiol (E2) and 17?-Estradiol as Determined by Solution NMR.
Ontology highlight
ABSTRACT:
SUBMITTER: Guo J
PROVIDER: S-EPMC3063361 | biostudies-literature | 2010 Jul
REPOSITORIES: biostudies-literature
Publications
The Conformations of 17β-Estradiol (E2) and 17α-Estradiol as Determined by Solution NMR.
Guo Jianxin J Duclos Richard I RI Vemuri V Kiran VK Makriyannis Alexandros A
Tetrahedron letters 20100701 27
The conformational structures of the hormone 17β-estradiol (E2) and the epimeric 17α-estradiol determined by solution NMR spectroscopy and restrained molecular dynamics calculations found a single low energy conformation. ...[more]
Similar Datasets
Project description:17α-Ethinyl estradiol (EE), a synthetic analog of natural estrogen 17β-estradiol (E2), is extensively used in hormonal contraceptives and estrogen replacement therapy, and it has also been found in sewage effluents. Given that E2 is a well-known immunomodulator, surprisingly there has been only limited information on the cellular and molecular immunologic consequences of exposure to EE. To address this fundamental gap, we directly compared the effects of EE with E2 on splenic leukocytes of New Zealand Black × New Zealand White F1 progeny (NZB/WF1) mice during the preautoimmune period. We found that EE and E2 have common, as well as distinctive, immunologic effects, with EE exposure resulting in more profound effects. Both EE and E2 increased numbers of splenic neutrophils, enhanced neutrophil serine proteases and myeloperoxidase expression, promoted the production of nitric oxide and monocyte chemoattractant protein-1, and altered adaptive immune T cell subsets. However, activation of splenic leukocytes through the T cell receptor or Toll-like receptor (TLR)4 revealed not only common (IL-10), but also hormone-specific alterations of cytokines (IFNγ, IL-1β, ΤΝFα, IL-2). Furthermore, in EE-exposed mice, TLR9 stimulation suppressed IFNα, in contrast to increased IFNα from E2-exposed mice. EE and E2 regulated common and hormone-specific expression of immune-related genes. Furthermore, EE exposure resulted in more marked alterations in miRNA expression levels than for E2. Only EE was able to reduce global DNA methylation significantly in splenic leukocytes. Taken together, our novel data revealed that EE and E2 exposure confers more similar effects in innate immune system-related cell development and responses, but has more differential regulatory effects in adaptive immune-related cell development and responses.
| S-EPMC6305969 | biostudies-literature
Project description:Transcriptional profiling of zebrafish (Danio rerio) livers comparing control untreated fish with fish treated with estrogen [17β-estradiol (E2)] for different time points (4, 12, 24, 48 hours).
2013-06-28 | GSE45562 | GEO
Project description:Protein structure determination by NMR has predominantly relied on simulated annealing-based conformational search for a converged fold using primarily distance constraints, including constraints derived from nuclear Overhauser effects, paramagnetic relaxation enhancement, and cysteine crosslinkings. Although there is no guarantee that the converged fold represents the global minimum of the conformational space, it is generally accepted that good convergence is synonymous to the global minimum. Here, we show such a criterion breaks down in the presence of large numbers of ambiguous constraints from NMR experiments on homo-oligomeric protein complexes. A systematic evaluation of the conformational solutions that satisfy the NMR constraints of a trimeric membrane protein, DAGK, reveals 9 distinct folds, including the reported NMR and crystal structures. This result highlights the fundamental limitation of global fold determination for homo-oligomeric proteins using ambiguous distance constraints and provides a systematic solution for exhaustive enumeration of all satisfying solutions.
| S-EPMC4568557 | biostudies-literature
Project description:BackgroundIn several species, considerably higher levels of estradiol-17 (E2) are synthesized in the CL. E2 has been suggested to participate in the regulation of luteal steroidogenesis and luteal cell morphology. In pregnant rats, several experiments have been carried out to examine the effects of inhibition of luteal E2 synthesis on CL structure and function.MethodsDuring days 12-15 of pregnancy in rats, luteal E2 was inhibited by way of daily oral administration of anastrozole (AI), a selective non-steroidal aromatase inhibitor, and experiments were also performed with E2 replacement i.e. AI+ E2 treatments. Luteal tissues from different treatment groups were subjected to microarray analysis and the differentially expressed genes in E2 treated group were further examined for expression of specific E2 responsive genes. Additional experiments were carried out employing recombinant growth hormone preparation and flutamide, an androgen receptor antagonist, to further address the specificity of E2 effects on the luteal tissue.ResultsMicroarray analysis of CL collected on day 16 of pregnancy post AI and AI+E2 treatments showed significantly lowered cyp19a1 expression, E2 levels and differential expression of a number of genes, and several of them were reversed in E2 replacement studies. From the differentially expressed genes, a number of E2 responsive genes were identified. In CL of AI pregnant rats, non-significant increase in expression of igf1, significant increase in igbp5, igf1r and decrease in expression of Erα were observed. In liver of AI treated rats, igf1 expression did not increase, but GH treatment significantly increased expression that was further increased with AI treatment. In CL of GH and AI+GH treated rats, expression of igfbp5 was higher. Administration of flutamide during days 12-15 of pregnancy resulted in non-significant increase in igfbp5 expression, however, combination of flutamide+AI treatments caused increased protein expression. Expression of few of the molecules in PI3K/Akt kinase pathway in different treatments was determined.ConclusionsThe results suggest a role for E2 in the regulation of luteal steroidogenesis, morphology and proliferation. igfbp5 was identified as one the E2 responsive genes with important role in the mediation of E2 actions such as E2-induced phosphorylation of PI3K/Akt kinase pathway.
| S-EPMC4830059 | biostudies-literature
Project description:Corpus luteum (CL) is a transient endocrine tissue formed from the remnants of the ovarian follicle after ovulation. In response to gonadotropin surge, the ovulating follicle undergoes dramatic changes in expression of genes and differentiation of follicular cells into luteal cells. In several species, of the several genes that are down- regulated post ovulation, Cyp19A1 that codes for aromatase, essential for biosynthesis of estradiol- 17β (E2), also get down- regulated but appears to get up- regulated at later time points in the estrous cycle to have critical role in E2 secretion. In primates and rodents, higher expression and higher E2 levels has been observed in CL. Surprisingly, in the recently carried out gene expression profiling of PGF2α- induced luteolysis studies in the bovine species [GSE27961], it was observed that expression of one of the earliest genes that was down- regulated was Cyp19A1 in the CL. However, the specific role of E2 in the regulation of CL function remains poorly defined. Thus, in the present study, efforts were made to examine the temporal changes in the global gene expression profile in the CL of pregnant rats after treatment with aromatase inhibitor (AI), Anastrozole, and E2 supplementation. The results obtained will further expand our knowledge on E2 target/responsive genes and the basic mechanism(s) that regulates the CL function. Key words: CL, E2, AI, Gene expression
2012-10-23 | GSE41735 | GEO
Project description:The principal conformational features of the mutant trp operator [d(CGTACTGATTAATCAGTACG)2] have been determined by n.m.r. at different temperatures. The sugar puckers were determined from J-resolved spectroscopy and high-resolution homonuclear Hartmann-Hahn spectroscopic (HOHAHA) experiments. Extensive one-dimensional nuclear-Overhauser-enhancement (NOE) data sets were acquired at 25 degrees C using irradiation times of 50, 100, 200, 300 and 500 ms to generate sufficient NOE information to determine the individual nucleotide conformations, and place limits on the local helical parameters, using multi-spin least-squares fitting and searching in conformation space with the program NUCFIT [Lane (1990) Biochim. Biophys. Acta 1049, 189-204]. The conformations of the nucleotides are well determined, and show significant sequence-dependent variation. Pyrimidine residues on average have a wider range of sugar conformations and smaller glycosidic torsion angles than purine residues. The helical parameters are in general less well determined, though clear evidence was obtained for sequence-dependent variation of the helical twist. The overall mean fractional deviation of the calculated from the observed NOEs was 0.108. The conformations of the base-pairs TAAT are temperature-dependent [Lane (1989) Biochem. J. 259, 715-724]. NOESY spectra were recorded at 10, 25 and 40 degrees C, using mixing times inversely proportional to the overall tumbling time to allow changes in the conformation to be described. A more detailed analysis was made using one-dimensional NOEs collected for nucleotides involved in the conformational transitions. There are significant temperature-dependent changes in the conformations of the central base-pairs from T9 to T13 with the largest changes in the glycosidic torsion angle occurring for A11 and A12 (up to 30 degrees). The orientation of the base-pairs T9-A12:T10-A11 also changes, with an increase in the base-pair roll and an unwinding of the helix as the temperature is increased. The conformational changes are qualitatively similar to those observed in a related sequence (Lefèvre, Lane & Jardetzky (1988) Biochemistry 27, 1086-1094]. The conformation is also similar to the wild-type sequence and to that observed in the crystal state in the complex with the trp holorepressor. The similarity suggests that the mutation produces a poorer operator by virtue of removal of essential functional groups within the major groove.
| S-EPMC1149857 | biostudies-other
Project description:This SuperSeries is composed of the SubSeries listed below.
2018-12-10 | GSE121745 | GEO
Project description:We used the NanoString mouse nCounter immunology panel platform to compare mRNA gene expression profiles of spelnocytes from placebo-, E2, and EE exposed NZB/WF1 mice. With the profling of 548 immunology-related genes, we found that E2 and EE exposure alter immune-related genes at a similar pattern.
2018-12-10 | GSE121743 | GEO
Project description:We used the NanoString mouse nCounter miRNA expression platform to compare the miRNA expression profiles of spelnocytes from placebo-, E2, and EE exposed NZB/WF1 mice. We found that EE exposure has a more profound effect than E2 on miRNA genes expression in splenocytes
2018-12-10 | GSE121744 | GEO
Project description:Although 17β-estradiol (E2) is a natural molecule involved in the endocrine system, its widespread use in various applications has resulted in its accumulation in the environment and its classification as an endocrine-disrupting molecule. These molecules can interfere with the hormonal system, and have been linked to various adverse effects such as the proliferation of breast cancer. It has been proposed that E2 could contribute to breast cancer by the induction of DNA damage. Mass spectrometry has demonstrated that E2 can bind to DNA but the mechanism by which E2 interacts with DNA has yet to be elucidated. Using all-atom molecular dynamics simulations, we demonstrate that E2 intercalates (inserts between two successive DNA base pairs) in DNA at the location specific to estrogen receptor binding, known as the estrogen response element (ERE), and to other random sequences of DNA. Our results suggest that excess E2 has the potential to disrupt processes in the body which rely on binding to DNA, such as the binding of the estrogen receptor to the ERE and the activity of enzymes that bind DNA, and could lead to DNA damage.
| S-EPMC5196241 | biostudies-literature