Browse
Submit Data
Databases
API
Help

Dataset Information

22 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Control of human beta-globin mRNA stability and its impact on beta-thalassemia phenotype.

ABSTRACT: Messenger RNA (mRNA) stability is a critical determinant that affects gene expression. Many pathways have evolved to modulate mRNA stability in response to developmental, physiological and/or environmental stimuli. Eukaryotic mRNAs have a considerable range of half-lives, from as short as a few minutes to as long as several days. Human globin mRNAs constitute an example of highly stable mRNAs. However, a wide variety of naturally occurring mutations that result in the clinical syndrome of thalassemia can trigger accelerated mRNA decay thus controlling mRNA quality prior to translation. Distinct surveillance mechanisms have been described as being targeted for specific defective globin mRNAs. Here, we review mRNA stability mechanisms implicated in the control of ?-globin gene expression and the surveillance pathways that prevent translation of aberrant ?-globin mRNAs. In addition, we emphasize the importance of these pathways in modulating the severity of the ?-thalassemia phenotype.

SUBMITTER: Peixeiro I

PROVIDER: S-EPMC3105653 | biostudies-literature | 2011 Jun

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Control of human beta-globin mRNA stability and its impact on beta-thalassemia phenotype.

Peixeiro Isabel I Silva Ana Luísa AL Romão Luísa L

Haematologica 20110228 6

Messenger RNA (mRNA) stability is a critical determinant that affects gene expression. Many pathways have evolved to modulate mRNA stability in response to developmental, physiological and/or environmental stimuli. Eukaryotic mRNAs have a considerable range of half-lives, from as short as a few minutes to as long as several days. Human globin mRNAs constitute an example of highly stable mRNAs. However, a wide variety of naturally occurring mutations that result in the clinical syndrome of thalas ...[more]

PMID: 21357703

Similar Datasets

CRISPR/Cas9-mediated β-globin gene knockout in rabbits recapitulates human β-thalassemia.

Project description:β-thalassemia, an autosomal recessive blood disorder that reduces the production of hemoglobin, is majorly caused by the point mutation of the HBB gene resulting in reduced or absent β-globin chains of the hemoglobin tetramer. Animal models recapitulating both the phenotype and genotype of human disease are valuable in the exploration of pathophysiology and for in vivo evaluation of novel therapeutic treatments. The docile temperament, short vital cycles, and low cost of rabbits make them an attractive animal model. However, β-thalassemia rabbit models are currently unavailable. Here, using CRISPR/Cas9-mediated genome editing, we point mutated the rabbit β-globin gene HBB2 with high efficiency and generated a β-thalassemia rabbit model. Hematological and histological analyses demonstrated that the genotypic mosaic F0 displayed a mild phenotype of anemia, and the heterozygous F1 exhibited typical characteristics of β-thalassemia. Whole-blood transcriptome analysis revealed that the gene expression was altered in HBB2-targeted when compared with WT rabbits. And the highly expressed genes in HBB2-targeted rabbits were enriched in lipid and iron metabolism, innate immunity, and hematopoietic processes. In conclusion, using CRISPR-mediated HBB2 knockout, we have created a β-thalassemia rabbit model that accurately recapitulates the human disease phenotype. We believe this tool will be valuable in advancing the investigation of pathogenesis and novel therapeutic targets of β-thalassemia and associated complications.

| S-EPMC8024976 | biostudies-literature

DNA methylation patterns of β-globin cluster in β-thalassemia patients.

Project description:BackgroundReactivation of fetal hemoglobin (HbF, α2γ2) holds a therapeutic target for β-thalassemia and sickle cell disease. Although many HbF regulators have been identified, the methylation patterns in β-globin cluster driving the fetal-to-adult hemoglobin switch remains to be determined.ResultsHere, we evaluated DNA methylation patterns of the β-globin cluster from peripheral bloods of 105 β0/β0 thalassemia patients and 44 normal controls. We also recruited 15 bone marrows and 4 cord blood samples for further evaluation. We identified that the CpG sites in the locus control region (LCR) DNase I hypersensitive site 4 and 3 (HS4-3) regions, and γ- and β-globin promoters displayed hypomethylation in β0/β0-thalassemia patients, especially for the patients with high HbF level, as compared with normal controls. Furthermore, hypomethylations in most of CpG sites of the HS4-3 core regions were also observed in bone marrows (BM) of β0/β0-patients compared with normal controls; and methylation level of γ-globin promoter -50 and + 17 CpG sites showed lower methylation level in patients with high HbF level compared with those with low HbF level and a negative correlation with HbF level among β0-thalassemia patients. Finally, γ-globin promoter + 17 and + 50 CpG sites also displayed significant hypomethylation in cord blood (CB) tissues compared with BM tissues from normal controls.ConclusionsOur findings revealed methylation patterns in β-globin cluster associated with β0 thalassemia disease and γ-globin expression, contributed to understand the epigenetic modification in β0 thalassemia patients and provided candidate targets for the therapies of β-hemoglobinopathies.

| S-EPMC7712619 | biostudies-literature

Beta-thalassemia: from genotype to phenotype.

Project description: Not available

| S-EPMC3208672 | biostudies-literature

Epigenetic inactivation of ERF reactivates γ-globin expression in β-thalassemia.

Project description:The fetal-to-adult hemoglobin switch is regulated in a developmental stage-specific manner and reactivation of fetal hemoglobin (HbF) has therapeutic implications for treatment of β-thalassemia and sickle cell anemia, two major global health problems. Although significant progress has been made in our understanding of the molecular mechanism of the fetal-to-adult hemoglobin switch, the mechanism of epigenetic regulation of HbF silencing remains to be fully defined. Here, we performed whole-genome bisulfite sequencing and RNA sequencing analysis of the bone marrow-derived GYPA+ erythroid cells from β-thalassemia-affected individuals with widely varying levels of HbF groups (HbF ≥ 95th percentile or HbF ≤ 5th percentile) to screen epigenetic modulators of HbF and phenotypic diversity of β-thalassemia. We identified an ETS2 repressor factor encoded by ERF, whose promoter hypermethylation and mRNA downregulation are associated with high HbF levels in β-thalassemia. We further observed that hypermethylation of the ERF promoter mediated by enrichment of DNMT3A leads to demethylation of γ-globin genes and attenuation of binding of ERF on the HBG promoter and eventually re-activation of HbF in β-thalassemia. We demonstrated that ERF depletion markedly increased HbF production in human CD34+ erythroid progenitor cells, HUDEP-2 cell lines, and transplanted NCG-Kit-V831M mice. ERF represses γ-globin expression by directly binding to two consensus motifs regulating γ-globin gene expression. Importantly, ERF depletion did not affect maturation of erythroid cells. Identification of alterations in DNA methylation of ERF as a modulator of HbF synthesis opens up therapeutic targets for β-hemoglobinopathies.

| S-EPMC8059375 | biostudies-literature

Integrated protein quality-control pathways regulate free ?-globin in murine ?-thalassemia.

Project description:Cells remove unstable polypeptides through protein quality-control (PQC) pathways such as ubiquitin-mediated proteolysis and autophagy. In the present study, we investigated how these pathways are used in ?-thalassemia, a common hemoglobinopathy in which ?-globin gene mutations cause the accumulation and precipitation of cytotoxic ?-globin subunits. In ?-thalassemic erythrocyte precursors, free ?-globin was polyubiquitinated and degraded by the proteasome. These cells exhibited enhanced proteasome activity, and transcriptional profiling revealed coordinated induction of most proteasome subunits that was mediated by the stress-response transcription factor Nrf1. In isolated thalassemic cells, short-term proteasome inhibition blocked the degradation of free ?-globin. In contrast, prolonged in vivo treatment of ?-thalassemic mice with the proteasome inhibitor bortezomib did not enhance the accumulation of free ?-globin. Rather, systemic proteasome inhibition activated compensatory proteotoxic stress-response mechanisms, including autophagy, which cooperated with ubiquitin-mediated proteolysis to degrade free ?-globin in erythroid cells. Our findings show that multiple interregulated PQC responses degrade excess ?-globin. Therefore, ?-thalassemia fits into the broader framework of protein-aggregation disorders that use PQC pathways as cell-protective mechanisms.

| S-EPMC3369615 | biostudies-literature

Editing an α-globin enhancer in primary human hematopoietic stem cells as a treatment for β-thalassemia.

Project description:β-Thalassemia is one of the most common inherited anemias, with no effective cure for most patients. The pathophysiology reflects an imbalance between α- and β-globin chains with an excess of free α-globin chains causing ineffective erythropoiesis and hemolysis. When α-thalassemia is co-inherited with β-thalassemia, excess free α-globin chains are reduced significantly ameliorating the clinical severity. Here we demonstrate the use of CRISPR/Cas9 genome editing of primary human hematopoietic stem/progenitor (CD34+) cells to emulate a natural mutation, which deletes the MCS-R2 α-globin enhancer and causes α-thalassemia. When edited CD34+ cells are differentiated into erythroid cells, we observe the expected reduction in α-globin expression and a correction of the pathologic globin chain imbalance in cells from patients with β-thalassemia. Xenograft assays show that a proportion of the edited CD34+ cells are long-term repopulating hematopoietic stem cells, demonstrating the potential of this approach for translation into a therapy for β-thalassemia.β-thalassemia is characterised by the presence of an excess of α-globin chains, which contribute to erythrocyte pathology. Here the authors use CRISP/Cas9 to reduce α-globin expression in hematopoietic precursors, and show effectiveness in xenograft assays in mice.

| S-EPMC5583283 | biostudies-literature

Reciprocal regulation of γ-globin expression by exo-miRNAs: Relevance to γ-globin silencing in β-thalassemia major.

Project description:Induction of fetal hemoglobin (HbF) is a promising strategy in the treatment of β-thalassemia major (β-TM). The present study shows that plasma exosomal miRNAs (exo-miRs) are involved in γ-globin regulation. Exosomes shuttle miRNAs and mediate cell-cell communication. MiRNAs are regulators of biological processes through post-transcriptional targeting. Compared to HD (Healthy Donor), β-TM patients showed increased levels of plasma exosomes and the majority of exosomes had cellular origin from CD34+ cells. Further, HD and β-TM exosomes showed differential miRNA expressions. Among them, deregulated miR-223-3p and miR-138-5p in β-TM exosomes and HD had specific targets for γ-globin regulator and repressor respectively. Functional studies in K562 cells showed that HD exosomes and miR-138-5p regulated γ-globin expression by targeting BCL11A. β-TM exosomes and miR-223-3p down regulated γ-globin expression through LMO2 targeting. Importantly, miR-223-3p targeting through sponge repression resulted in γ-globin activation. Further, hnRNPA1 bound to stem-loop structure of pre-miR-223 and we found that hnRNPA1 knockdown or mutagenesis at miR-223-3p stem-loop sequence resulted in less mature exo-miR-223-3p levels. Altogether, the study shows for the first time on the important clinical evidence that differentially expressed exo-miRNAs reciprocally control γ-globin expressions. Further, the hnRNPA1-exo-miR-223-LMO2 axis may be critical to γ-globin silencing in β-TM.

| S-EPMC5427890 | biostudies-literature

SOX6 Downregulation Induces ?-Globin in Human ?-Thalassemia Major Erythroid Cells.

Project description:Fetal hemoglobin (HbF; ?2?2) is a potent genetic modifier of the severity of ?-thalassemia and sickle cell anemia. Differences in the levels of HbF that persist into adulthood affect the severity of sickle cell disease and the ?-thalassemia syndromes. Sry type HMG box (SOX6) is a potent silencer of HbF. Here, we reactivated ?-globin expression by downregulating SOX6 to alleviate anemia in the ?-thalassemia patients.SOX6 was downregulated by lentiviral RNAi (RNA interference) in K562 cell line and an in vitro culture model of human erythropoiesis in which erythroblasts are derived from the normal donor mononuclear cells (MNC) or ?-thalassemia major MNC. The expression of ?-globin was analyzed by qPCR (quantitative real-time PCR) and WB (western blot).Our data showed that downregulation of SOX6 induces ?-globin production in K562 cell line and human erythrocytes from normal donors and ?-thalassemia major donors, without altering erythroid maturation.This is the first report on ?-globin induction by downregulation of SOX6 in human erythroblasts derived from ?-thalassemia major.

| S-EPMC5733236 | biostudies-literature

Correction of β-thalassemia by CRISPR/Cas9 editing of the α-globin locus in human hematopoietic stem cells.

Project description:β-thalassemias (β-thal) are a group of blood disorders caused by mutations in the β-globin gene (HBB) cluster. β-globin associates with α-globin to form adult hemoglobin (HbA, α2β2), the main oxygen-carrier in erythrocytes. When β-globin chains are absent or limiting, free α-globins precipitate and damage cell membranes, causing hemolysis and ineffective erythropoiesis. Clinical data show that severity of β-thal correlates with the number of inherited α-globin genes (HBA1 and HBA2), with α-globin gene deletions having a beneficial effect for patients. Here, we describe a novel strategy to treat β-thal based on genome editing of the α-globin locus in human hematopoietic stem/progenitor cells (HSPCs). Using CRISPR/Cas9, we combined 2 therapeutic approaches: (1) α-globin downregulation, by deleting the HBA2 gene to recreate an α-thalassemia trait, and (2) β-globin expression, by targeted integration of a β-globin transgene downstream the HBA2 promoter. First, we optimized the CRISPR/Cas9 strategy and corrected the pathological phenotype in a cellular model of β-thalassemia (human erythroid progenitor cell [HUDEP-2] β0). Then, we edited healthy donor HSPCs and demonstrated that they maintained long-term repopulation capacity and multipotency in xenotransplanted mice. To assess the clinical potential of this approach, we next edited β-thal HSPCs and achieved correction of α/β globin imbalance in HSPC-derived erythroblasts. As a safer option for clinical translation, we performed editing in HSPCs using Cas9 nickase showing precise editing with no InDels. Overall, we described an innovative CRISPR/Cas9 approach to improve α/β globin imbalance in thalassemic HSPCs, paving the way for novel therapeutic strategies for β-thal.

| S-EPMC7948300 | biostudies-literature

Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families.

Project description:β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations lead to β-thalassemia trait. However, when compounded with other β0-thalassemia, it may behave with β-thalassemia intermedia or β-thalassemia major. Our study broadens the variants spectral of β-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

| S-EPMC10704694 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data