Dataset Information

Determination of target sequence bound by PapX, repressor of bacterial motility, in flhD promoter using systematic evolution of ligands by exponential enrichment (SELEX) and high throughput sequencing.

ABSTRACT: Most uncomplicated urinary tract infections (UTIs) are caused by uropathogenic Escherichia coli (UPEC). Both motility and adherence are integral to UTI pathogenesis, yet they represent opposing forces. Therefore, it is logical to reciprocally regulate these functions. In UPEC strain CFT073, PapX, a non-structural protein encoded by one of the two pap operons encoding P fimbria adherence factor, represses flagella-mediated motility and is a putative member of the winged helix transcription factor family. The mechanism of this repression, however, is not understood. papX is found preferentially in more virulent UPEC isolates, being significantly more prevalent in pyelonephritis strains (53% of isolates) than in asymptomatic bacteriuria (32%) or fecal/commensal (12.5%) strains. To examine PapX structure-function, we generated papX linker insertion and site-directed mutants, which identified two key residues for PapX function (Lys(54) and Arg(127)) within domains predicted by modeling with I-TASSER software to be important for dimerization and DNA binding, respectively. To determine the PapX binding site in the CFT073 genome, systematic evolution of ligands by exponential enrichment (SELEX) in conjunction with high throughput sequencing was utilized for the first time to determine a novel binding site for a bacterial transcription factor. This method identified a 29-bp binding site within the flhDC promoter (TTACGGTGAGTTATTTTAACTGTGCGCAA), centered 410 bp upstream of the flhD translational start site. Gel shift experiments demonstrated that PapX binds directly to this site to repress transcription of flagellar genes.

SUBMITTER: Reiss DJ

PROVIDER: S-EPMC3247938 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Similar Datasets

Project description:DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified systematic evolution of ligands by exponential enrichment (SELEX) approach. Two Taq-specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. TaqI contained 8 nucleotides (5'-CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCRs. Similarly, exonuclease- Klenow polymerase also selected a high-affinity primer that contained a related core promoter sequence from phage T7 RNAP (5'-ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity, suggesting that binding was highly sequence specific. The results are discussed in the context of possible effects on multiprimer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs.IMPORTANCE This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function or be a consequence of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered, and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of ancestral DNA polymerases to develop their promoters. Conversely, DNA polymerases could have evolved from related RNA polymerases and retained the intrinsic binding preference despite there being no clear function for such a preference in DNA biology.

Project description:Capillary electrophoresis-systematic evolution of ligands by exponential enrichment (CE-SELEX) is a powerful technique for isolating aptamers for various targets, from large proteins to small peptides with molecular weights of several kilodaltons. One of the unique characteristics of CE-SELEX is the relatively high heterogeneity of the ssDNA pools that remains even after multiple rounds of selection. Enriched sequences or highly abundant oligonucleotide motifs are rarely reported in CE-SELEX studies. In this work, we employed 454 pyrosequencing to profile the evolution of an oligonucleotide pool through multiple rounds of CE-SELEX selection against the target recombinant human vascular endothelial growth factor 165 (rhVEGF165). High throughput sequencing allowed up to 3 × 10(4) sequences to be obtained from each selected pool and compared to the unselected library. Remarkably, the highest abundance contiguous sequence (contig) was only present in 0.8% of sequences even after four rounds of selection. Closer analyses of the most abundant contigs, the top 1000 oligonucleotide fragments, and even the eight original FASTA files showed no evidence of prevailing motifs in the selected pools. The sequencing results also provided insight into why many CE-SELEX selections obtain pools with reduced affinities after many rounds of selection (typically >4). Preferential amplification of a particular short polymerase chain reaction (PCR) product allowed this nonbinding sequence to overtake the pool in later rounds of selection suggesting that further refinement of primer design or amplification optimization is necessary. High affinity aptamers with 10(-8) M dissociation constants for rhVEGF165 were identified. The affinities of the higher abundance contigs were compared with aptamers randomly chosen from the final selection pool using affinity capillary electrophoresis (ACE) and fluorescence polarization (FP). No statistical difference in affinity between the higher abundance contigs and the randomly chosen aptamers was observed, supporting the premise that CE-SELEX selects a uniquely heterogeneous pool of high affinity aptamers.

Dataset Information

Determination of target sequence bound by PapX, repressor of bacterial motility, in flhD promoter using systematic evolution of ligands by exponential enrichment (SELEX) and high throughput sequencing.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets