Browse
Submit Data
Databases
API
Help

Dataset Information

24 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Binding mode of CpG oligodeoxynucleotides to nanoparticles regulates bifurcated cytokine induction via Toll-like receptor 9.

ABSTRACT: The interaction of cytosine-phosphate-guanine oligodeoxynucleotides (CpG ODNs) with Toll-like receptor 9 (TLR9) activates the immune system. Multimeric class A CpG ODNs induce interferon-? (IFN-?) and, to a lesser extent, interleukin-6. By contrast, monomeric class B CpG ODNs induce interleukin-6 but not IFN-?. This difference suggests that the multimerization of CpG ODN molecules is a key factor in IFN-? induction. We multimerized class B CpG ODN2006x3-PD molecules that consist entirely of a phosphodiester backbone onto quantum dot silicon nanoparticles with various binding modes. Herein, we present the binding mode-dependent bifurcation of cytokine induction and discuss its possible mechanism of CpG ODN and TLR9 interaction. Our discoveries also suggest that nanoparticles play roles in not only delivery of CpG ODNs but also control of CpG ODN activity.

SUBMITTER: Chinnathambi S

PROVIDER: S-EPMC3405294 | biostudies-literature | 2012

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Binding mode of CpG oligodeoxynucleotides to nanoparticles regulates bifurcated cytokine induction via Toll-like receptor 9.

Chinnathambi Shanmugavel S Chen Song S Ganesan Singaravelu S Hanagata Nobutaka N

Scientific reports 20120726

The interaction of cytosine-phosphate-guanine oligodeoxynucleotides (CpG ODNs) with Toll-like receptor 9 (TLR9) activates the immune system. Multimeric class A CpG ODNs induce interferon-α (IFN-α) and, to a lesser extent, interleukin-6. By contrast, monomeric class B CpG ODNs induce interleukin-6 but not IFN-α. This difference suggests that the multimerization of CpG ODN molecules is a key factor in IFN-α induction. We multimerized class B CpG ODN2006x3-PD molecules that consist entirely of a ph ...[more]

PMID: 22837814

Similar Datasets

CpG Oligodeoxynucleotides Induce Differential Cytokine and Chemokine Gene Expression Profiles in Dapulian and Landrace Pigs.

Project description:Oligodeoxynucleotides containing unmethylated CpG motifs (CpG ODN) mimic the immunostimulatory activity of microbial DNA by interacting with Toll-like receptor 9 (TLR9) to activate both the innate and adaptive immune responses in different species. However, few studies have been published to compare the effects of CpG ODN on different pig breeds. Therefore, in this study, whole blood gene expression profiles of DPL and Landrace pigs treated with CpG ODN were studied using RNA-seq technology. Five Hundred differentially expressed genes (DEGs) were identified between the two breeds. DPL pigs had significantly higher number of immune-relevant DEGs than the Landrace pigs after CpG ODN treatment. Pathway analysis showed that cytokine-cytokine receptor interaction and chemokine signaling pathway were the major enriched pathways of the immune-relevant DEGs. Further in vitro experiments showed that PBMCs of the DPL pigs had significantly higher levels of TLR9 mRNA than those of the Landrace pigs, both before and after CpG ODN stimulation. Cytokine and chemokine induction in the PBMCs of both breeds were also measured after CpG ODN stimulation. Our data showed that mRNA levels of cytokines (IFN?, IL8, IL12 p40) and chemokines (CXCL9, CXCL13) were significantly higher in the PBMCs of the DPL pigs than those of the Landrace pigs. Taken together, our data provide new information regarding the pig breed difference in response to CpG ODN stimulation and that higher levels of TLR9 mRNA in DPL pigs may be a major contributor for disease resistance.

| S-EPMC5156958 | biostudies-literature

Phosphodiester backbone of the CpG motif within immunostimulatory oligodeoxynucleotides augments activation of Toll-like receptor 9.

Project description:Toll-like receptor 9 (TLR9) stimulatory CpG-containing oligodeoxynucleotides (ODNs) with phosphorothioate backbones have successfully replaced the naturally occurring agonists of TLR9 in drug development due to their increased stability. Replacing the nonbridging oxygen with a sulfur atom in the phosphate linkage of ODNs has been accepted as having a minor impact on the chemical and physical properties of the agonists. Here, we report that the TLR9 binding site exhibits a strong bias in favor of a phosphodiester backbone over the phosphorothioate backbone of the CpG motif. Furthermore, we show that while single point mutations of W47, W96 and K690 within the TLR9 binding site retains full TLR9 activation by phosphodiester-based ODNs, activation by phosphorothioate-based ODNs is strongly impaired. The substitution of a phosphorothioate linkage for a phosphodiester linkage of just the CpG motif considerably improves the activation potency of a phosphorothioate-based oligonucleotide for human B-cells and plasmacytoid dendritic cells, as well as for mouse bone marrow-derived dendritic cells and macrophages. Our results highlight the functional significance of the phosphodiester linkage of a CpG dinucleotide for binding, which is important in designing improved immunostimulatory TLR9 agonists.

| S-EPMC5668283 | biostudies-literature

PIKfyve regulates the endosomal localization of CpG oligodeoxynucleotides to elicit TLR9-dependent cellular responses.

Project description:TLR9 is a receptor for oligodeoxynucleotides that contain unmethylated CpG motifs (CpG). Because TLR9 resides in the endoplasmic reticulum during the quiescence state, CpG binding to TLR9 requires membrane trafficking, which includes the maturation of the CpG-containing endosome. In the present study, we examined the role of PIKfyve, a phosphatidylinositol 3-phosphate 5-kinase, in the regulation of TLR9 signaling. The PIKfyve inhibitor YM201636 inhibited co-localization of the CpG-containing endosome with LysoTracker, which stains acidic organelle, and with TLR9. YM201636 increased the co-localization of CpG with the early endosome marker EEA1 but decreased co-localization with the late endosome marker LAMP1. Similar results were obtained in Raw264.7 cells containing shRNA that targets PIKfyve. CpG-mediated phosphorylation but not lipopolysaccharide (LPS)-mediated phosphorylation of IKK, p38 MAPK, JNK and Stat3 was severely impaired by the loss of PIKfyve function. CpG-mediated expression of cytokine mRNA was also decreased in the absence of PIKfyve. These findings demonstrate a novel role of PIKfyve in TLR9 signaling.

| S-EPMC3767827 | biostudies-literature

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

2013-04-02 | GSE26941 | GEO

CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responses.

Project description:Synthetic phosphorothiolate-modified CpG-oligodeoxynucleotides (CpG-ODNs) are potent immune stimuli. Toll-like receptor (TLR) 9 and TLR21 are their cellular receptors in different species. The structural requirements for CpG-ODN to strongly activate TLR9 have been relatively well studied, but studies on TLR21 are in their infancy. Therefore, in this study, we investigated the interaction between CpG-ODNs and TLR21s from groupers (Epinephelus spp.), which are economically important fish species. We cloned the cDNA of giant grouper (E. lanceolatus) TLR21, and compared its sequence with orange-spotted grouper (E. coioides) TLR21A and TLR21B. These three receptors were activated by CpG-ODNs containing the GTCGTT motif but not by those containing the GACGTT motif. We developed two CpG-ODNs that contained 19 phosphorothiolated deoxynucleotides with one or two GTCGTT motifs. These CpG-ODNs had better activity on grouper TLR21s than currently developed CpG-ODNs, and produced similar immune stimulatory profiles when applied to cells isolated from orange-spotted grouper. The developed CpG-ODNs also effectively activated both human and mouse TLR9-mediated NF-?B activation and cytokine productions. These findings suggest that the GTCGTT motif is required for CpG-ODNs to activate grouper TLR21s, and that the CpG-ODNs that were developed for grouper TLR21s contain structures that effectively activate human and mouse TLR9s.

| S-EPMC5725558 | biostudies-literature

Toll-like receptor 9 and 21 have different ligand recognition profiles and cooperatively mediate activity of CpG-oligodeoxynucleotides in zebrafish.

Project description:CpG-oligodeoxynucleotides (CpG-ODNs) are potent immune stimuli currently under investigation as antimicrobial agents for different species. Toll-like receptor (TLR) 9 and TLR21 are the cellular receptors of CpG-ODN in mammals and chickens, respectively. The avian genomes lack TLR9, whereas mammalian genomes lack TLR21. Although fish contain both of these genes, the biological functions of fish TLR9 and TLR21 have not been investigated previously. In this study, we comparatively investigated zebrafish TLR9 (zebTLR9) and TLR21 (zebTLR21). The two TLRs have similar expression profiles in zebrafish. They are expressed during early development stages and are preferentially expressed in innate immune function-related organs in adult fish. Results from cell-based activation assays indicate that these two zebrafish TLRs are functional, responding to CpG-ODN but not to other TLR ligands. zebTLR9 broadly recognized CpG-ODN with different CpG motifs, but CpG-ODN with GACGTT or AACGTT had better activity to this TLR. In contrast, zebTLR21 responded preferentially to CpG-ODN with GTCGTT motifs. The distinctive ligand recognition profiles of these two TLRs were determined by their ectodomains. Activation of these two TLRs by CpG-ODN occurred inside the cells and was modulated by UNC93B1. The biological functions of these two TLRs were further investigated. The CpG-ODNs that activate both zebTLR9 and zebTLR21 were more potent than others that activate only zebTLR9 in the activation of cytokine productions and were more bactericidal in zebrafish. These results suggest that zebTLR9 and zebTLR21 cooperatively mediate the antimicrobial activities of CpG-ODN. Overall, this study provides a molecular basis for the activities of CpG-ODN in fish.

| S-EPMC3870712 | biostudies-literature

CpG Oligodeoxynucleotides treatment of Anopheles mosquitoes

Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.

2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress

Down-regulation of ATP-binding cassette transporter G1 expression by unmethylated CpG oligodeoxynucleotides in RAW 264.7 macrophages.

Project description:We have investigated the effect of various forms of phosphodiester cytidine-phosphate-guanosine oligodeoxynucleotides (CpG ODNs) on the production of pro-inflammatory cytokines and related genes in RAW 264.7 macrophages. Treatment with the CpG ODNs increased the expression of tumor necrosis factor α (TNF-α), IL-6, and inducible nitric oxide synthase but not interleukin-1β (IL-1β). We also investigated the effect of CpG ODNs on the expression of ATP-binding cassette transporter A1 (ABCA1) and G1 (ABCG1) genes which are known to facilitate cholesterol efflux from macrophages for anti-atherosclerosis. CpG 2006 significantly reduced the levels of ABCG1 mRNA as determined by real-time polymerase chain reaction, whereas ABCA1 mRNA level was not changed. Western blot analysis further confirmed the reduction of ABCG1 protein expression by CpG 2006. In addition, we also determined the protein level of peroxisome proliferator activated receptor γ (PPARγ), which is recognized as a transcriptional activator of ABC transporters, was also reduced by CpG 2006. Thus, these results suggest that ABCG1 is specifically down-regulated by CpG 2006 in a PPARγ-dependent manner in macrophages.

| S-EPMC3203241 | biostudies-literature

Discovery of Imidazoquinolines with Toll-Like Receptor 7/8 Independent Cytokine Induction.

Project description:Toll-like receptors (TLRs) are key targets in the design of immunomodulating agents for use as vaccine adjuvants and anticancer treatments. The imidazoquinolines, imiquimod and resiquimod, have been shown to activate TLR-7 and -8 which in turn induce cytokine production as part of the innate immune response. Herein, we report the synthesis and discovery of a C7-methoxycarbonyl derivative of imiquimod that stimulates cytokine production but is devoid of TLR-7/8 activity. Data is presented that shows this analog not only induces IL-12p40 and TNF production, similar to that of imiquimod and resiquimod, but greatly enhances the production of IL-1β, a key cytokine involved in activation of CD4 T cells. It is further demonstrated that TLR-7/8 activation can be recovered by the addition of a C2-alkyl substituent to this newly discovered analog. The results support the existence of an alternative mechanism of action by which imidazoquinolines can stimulate cytokine production.

| S-EPMC3402226 | biostudies-literature

CpG oligodeoxynucleotides potentiate the antitumor activity of anti-BST2 antibody.

Project description:Numerous monoclonal antibodies (mAb) targeting tumor antigens have recently been developed. Antibody-dependent cellular cytotoxicity (ADCC) and antibody-dependent cellular phagocytosis (ADCP) via effector cells such as tumor-infiltrating natural killer (NK) cells and macrophages are often involved in mediating the antitumor activity of mAb. CpG oligodeoxynucleotides (ODN) have a potent antitumor activity and are considered to increase tumor infiltration of NK cells and macrophages. Our group previously reported significant antitumor activity of anti-bone marrow stromal antigen 2 (BST2) mAb against BST2-positive endometrial cancer cells through ADCC. In this study, we evaluated the synergistic antitumor activity of combination therapy with anti-BST-2 mAb and CpG ODN using SCID mice and elucidated the mechanisms underlying this activity. Anti-BST2 mAb and CpG ODN monotherapy had a significant dose-dependent antitumor activity (P = 0.0135 and P = 0.0196, respectively). Combination therapy with anti-BST2 mAb and CpG ODN had a significant antitumor activity in SCID mice (P < 0.01), but not in NOG mice. FACS analysis revealed significantly increased numbers of NK cells and macrophages in tumors treated with a combination of anti-BST2 mAb and CpG ODN and with CpG ODN alone in SCID mice (P < 0.05 and P < 0.01, respectively). These results suggested that the combination therapy with anti-BST2 mAb and CpG ODN has a significant antitumor activity and induces tumor infiltration of NK cells and macrophages. Combination therapy with CpG ODN and anti-BST2 mAb or other antitumor mAb depending on ADCC may represent a new treatment option for cancer.

| S-EPMC4638016 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data