Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

5'-Terminal chemical capping of spliced leader RNAs.

ABSTRACT: Spliced leader (SL) RNA trans-splicing adds a 2,2,7-trimethylguanosine cap (TMG) and a 22-nucleotide sequence, the SL, to the 5' end of mRNAs. Both non-trans-spliced with a monomethylguanosine cap (MMG) and trans-spliced mRNAs co-exist in trans-splicing metazoan cells. Efficient translation of TMG-capped mRNAs in nematodes requires a defined core of nucleotides within the SL sequence. Here we present a chemical procedure for the preparation and purification of 5'-terminal capped MMG and TMG wild-type, and mutant 22 nt spliced leader RNAs (GGU/ACUUAAUUACCCAAGUUUGAG) with or without a 3' biotin tag.

SUBMITTER: Piecyk K

PROVIDER: S-EPMC3501006 | biostudies-literature | 2012 Sep

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

5'-Terminal chemical capping of spliced leader RNAs.

Piecyk Karolina K Davis Richard E RE Jankowska-Anyszka Marzena M

Tetrahedron letters 20120704 36

Spliced leader (SL) RNA trans-splicing adds a 2,2,7-trimethylguanosine cap (TMG) and a 22-nucleotide sequence, the SL, to the 5' end of mRNAs. Both non-trans-spliced with a monomethylguanosine cap (MMG) and trans-spliced mRNAs co-exist in trans-splicing metazoan cells. Efficient translation of TMG-capped mRNAs in nematodes requires a defined core of nucleotides within the SL sequence. Here we present a chemical procedure for the preparation and purification of 5'-terminal capped MMG and TMG wild ...[more]

PMID: 23175583

Similar Datasets

Three small nucleolar RNAs identified from the spliced leader-associated RNA locus in kinetoplastid protozoans.

Project description:First characterized in Trypanosoma brucei, the spliced leader-associated (SLA) RNA gene locus has now been isolated from the kinetoplastids Leishmania tarentolae and Trypanosoma cruzi. In addition to the T. brucei SLA RNA, both L. tarentolae and T. cruzi SLA RNA repeat units also yield RNAs of 75 or 76 nucleotides (nt), 92 or 94 nt, and approximately 450 or approximately 350 nt, respectively, each with significant sequence identity to transcripts previously described from the T. brucei SLA RNA locus. Cell fractionation studies localize the three additional RNAs to the nucleolus; the presence of box C/D-like elements in two of the transcripts suggests that they are members of a class of small nucleolar RNAs (snoRNAs) that guide modification and cleavage of rRNAs. Candidate rRNA-snoRNA interactions can be found for one domain in each of the C/D element-containing RNAs. The putative target site for the 75/76-nt RNA is a highly conserved portion of the small subunit rRNA that contains 2'-O-ribose methylation at a conserved position (Gm1830) in L. tarentolae and in vertebrates. The 92/94-nt RNA has the potential to form base pairs near a conserved methylation site in the large subunit rRNA, which corresponds to position Gm4141 of small rRNA 2 in T. brucei. These data suggest that trypanosomatids do not obey the general 5-bp rule for snoRNA-mediated methylation.

| S-EPMC109026 | biostudies-literature

Chemical capping improves template switching and enhances sequencing of small RNAs.

Project description:Template-switching reverse transcription is widely used in RNA sequencing for low-input and low-quality samples, including RNA from single cells or formalin-fixed paraffin-embedded (FFPE) tissues. Previously, we identified the native eukaryotic mRNA 5' cap as a key structural element for enhancing template switching efficiency. Here, we introduce CapTS-seq, a new strategy for sequencing small RNAs that combines chemical capping and template switching. We probed a variety of non-native synthetic cap structures and found that an unmethylated guanosine triphosphate cap led to the lowest bias and highest efficiency for template switching. Through cross-examination of different nucleotides at the cap position, our data provided unequivocal evidence that the 5' cap acts as a template for the first nucleotide in reverse transcriptase-mediated post-templated addition to the emerging cDNA-a key feature to propel template switching. We deployed CapTS-seq for sequencing synthetic miRNAs, human total brain and liver FFPE RNA, and demonstrated that it consistently improves library quality for miRNAs in comparison with a gold standard template switching-based small RNA-seq kit.

| S-EPMC8754658 | biostudies-literature

SL2-like spliced leader RNAs in the basal nematode Prionchulus punctatus: New insight into the evolution of nematode SL2 RNAs.

Project description:Spliced-leader (SL) trans-splicing has been found in all molecularly characterized nematode species to date, and it is likely to be a nematode synapomorphy. Most information regarding SL trans-splicing has come from the study of nematodes from a single monophyletic group, the Rhabditida, all of which employ SL RNAs that are identical to, or variants of, the SL1 RNA first characterized in Caenorhabditis elegans. In contrast, the more distantly related Trichinella spiralis, belonging to the subclass Dorylaimia, utilizes a distinct set of SL RNAs that display considerable sequence diversity. To investigate whether this is true of other members of the Dorylaimia, we have characterized SL RNAs from Prionchulus punctatus. Surprisingly, this revealed the presence of a set of SLs that show clear sequence similarity to the SL2 family of spliced leaders, which have previously only been found within the rhabditine group (which includes C. elegans). Expression of one of the P. punctatus SL RNAs in C. elegans reveals that it can compete specifically with the endogenous C. elegans SL2 spliced leaders, being spliced to the pre-mRNAs derived from downstream genes in operons, but does not compete with the SL1 spliced leaders. This discovery raises the possibility that SL2-like spliced leaders were present in the last common ancestor of the nematode phylum.

| S-EPMC2905750 | biostudies-literature

Chemical capping improves template switching and enhances sequencing of small RNAs

Project description:We deployed CapTS-seq for sequencing synthetic miRNAs, human total brain RNA, and liver FFPE RNA, and demonstrated that chemical capping in conjunction with template switching consistently reduces sequencing bias and improves library quality in comparison with commercially available RNA-seq kits. Finally, we showed the simultaneous detection of miRNAs and mRNAs in FFPE derived samples, underscoring the potential of this workflow for dissecting regulatory networks between miRNAs and their target gene transcripts.

2021-09-13 | GSE171049 | GEO

Spliced leader RNA trans-splicing in dinoflagellates.

Project description:Through the analysis of hundreds of full-length cDNAs from fifteen species representing all major orders of dinoflagellates, we demonstrate that nuclear-encoded mRNAs in all species, from ancestral to derived lineages, are trans-spliced with the addition of the 22-nt conserved spliced leader (SL), DCCGUAGCCAUUUUGGCUCAAG (D = U, A, or G), to the 5' end. SL trans-splicing has been documented in a limited but diverse number of eukaryotes, in which this process makes it possible to translate polycistronically transcribed nuclear genes. In SL trans-splicing, SL-donor transcripts (SL RNAs) contain two functional domains: an exon that provides the SL for mRNA and an intron that contains a spliceosomal (Sm) binding site. In dinoflagellates, SL RNAs are unusually short at 50-60 nt, with a conserved Sm binding motif (AUUUUGG) located in the SL (exon) rather than the intron. The initiation nucleotide is predominantly U or A, an unusual feature that may affect capping, and hence the translation and stability of the recipient mRNA. The core SL element was found in mRNAs coding for a diverse array of proteins. Among the transcripts characterized were three homologs of Sm-complex subunits, indicating that the role of the Sm binding site is conserved, even if the location on the SL is not. Because association with an Sm-complex often signals nuclear import for U-rich small nuclear RNAs, it is unclear how this Sm binding site remains on mature mRNAs without impeding cytosolic localization or translation of the latter. The sequences reported in this paper have been deposited in the GenBank database (accession nos. AF 512889, DQ 864761-DQ 864971, DQ 867053-DQ 867070, DQ 884413-DQ 884451, EF 133854-EF 133905, EF 133961-EF 134003, EF 134083-EF 134402, EF 141835, and EF 143070-EF 143105).

| S-EPMC1838650 | biostudies-literature

Retrieval of missing spliced leader in dinoflagellates.

Project description:Spliced leader (SL) trans-splicing has recently been shown to be a common mRNA processing mechanism in dinoflagellates, in which a short (22-nt) sequence, DCCGUAGCCAUUUUGGCUCAAG (D = U, A, or G), is transplanted from the 5'-end of a small non-coding RNA (SL RNA) to the 5' end of mRNA molecules. The widespread existence of the mechanism in dinoflagellates has been demonstrated by detection of this SL (DinoSL) in a wide phylogenetic range of dinoflagellates. Furthermore, the presence of DinoSL in the transcripts of highly diverse groups of nuclear-encoded genes has led us to postulate that SL trans-splicing is universal in dinoflagellate nuclear genome. However, some observations inconsistent to this postulation have been reported, exemplified by a recent article reporting apparent absence of DinoSL in the transcripts of some nuclear-encoded genes in Amphidinium carterae. Absence of SL in these gene transcripts would have important implication on gene regulation in dinoflagellates and utility of DinoSL as a universal dinoflagellate-specific primer to study dinoflagellate transcriptomics. In this study, we re-examined transcripts of these genes and found that all of them actually contained DinoSL. Therefore, results to date are consistent to our initial postulation that DinoSL occurs in all dinoflagellate nuclear-encoded mRNAs.

| S-EPMC2606063 | biostudies-literature

Spliced leader RNA trans-splicing discovered in copepods.

Project description:Copepods are one of the most abundant metazoans in the marine ecosystem, constituting a critical link in aquatic food webs and contributing significantly to the global carbon budget, yet molecular mechanisms of their gene expression are not well understood. Here we report the detection of spliced leader (SL) trans-splicing in calanoid copepods. We have examined nine species of wild-caught copepods from Jiaozhou Bay, China that represent the major families of the calanoids. All these species contained a common 46-nt SL (CopepodSL). We further determined the size of CopepodSL precursor RNA (slRNA; 108-158 nt) through genomic analysis and 3'-RACE technique, which was confirmed by RNA blot analysis. Structure modeling showed that the copepod slRNA folded into typical slRNA secondary structures. Using a CopepodSL-based primer set, we selectively enriched and sequenced copepod full-length cDNAs, which led to the characterization of copepod transcripts and the cataloging of the complete set of 79 eukaryotic cytoplasmic ribosomal proteins (cRPs) for a single copepod species. We uncovered the SL trans-splicing in copepod natural populations, and demonstrated that CopepodSL was a sensitive and specific tool for copepod transcriptomic studies at both the individual and population levels and that it would be useful for metatranscriptomic analysis of copepods.

| S-EPMC4664967 | biostudies-literature

Trans-spliced leader addition to mRNAs in a cnidarian.

Project description:A search of databases with the sequence from the 5' untranslated region of a Hydra cDNA clone encoding a receptor protein-tyrosine kinase revealed that a number of Hydra cDNAs contain one of two different sequences at their 5' ends. This finding suggested the possibility that mRNAs in Hydra receive leader sequences by trans-splicing. This hypothesis was confirmed by the finding that the leader sequences are transcribed as parts of small RNAs encoded by genes located in the 5S rRNA clusters of Hydra. The two spliced leader (SL) RNAs (SL-A and -B) contain splice donor dinucleotides at the predicted positions, and genes that receive SLs contain splice acceptor dinucleotides at the predicted positions. Both of the SL RNAs are bound by antibody against trimethylguanosine, suggesting that they contain a trimethylguanosine cap. The predicted secondary structures of the Hydra SL RNAs show significant differences from the structures predicted for the SLs of other organisms. Messenger RNAs have been identified that can receive either SL-A or -B, although the impact of the two different SLs on the function of the mRNA is unknown. The presence and features of SL addition in the phylum Cnidaria raise interesting questions regarding the evolution of this process.

| S-EPMC33275 | biostudies-literature

Chemical synthesis of long RNAs with terminal 5'-phosphate groups.

Project description:Long structured RNAs are useful biochemical and biological tools. They are usually prepared enzymatically, but this precludes their site-specific modification with functional groups for chemical biology studies. One solution is to perform solid-phase synthesis of multiple RNAs loaded with 5'-terminal phosphate groups, so that RNAs can be concatenated using template ligation reactions. However, there are currently no readily available reagents suitable for the incorporation of the phosphate group into long RNAs by solid-phase synthesis. Here we describe an easy-to-prepare phosphoramidite reagent suitable for the chemical introduction of 5'-terminal phosphate groups into long RNAs. The phosphate is protected by a dinitrobenzhydryl group that serves as an essential lipophilic group for the separation of oligonucleotide by-products. The phosphate is unmasked quantitatively by brief UV irradiation. We demonstrate the value of this reagent in the preparation of a library of long structured RNAs that are site-specifically modified with functional groups.

| S-EPMC5413853 | biostudies-literature

Spliced leader trans-splicing in the nematode Trichinella spiralis uses highly polymorphic, noncanonical spliced leaders.

Project description:The trans-splicing of short spliced leader (SL) RNAs onto the 5' ends of mRNAs occurs in a diverse range of taxa. In nematodes, all species so far characterized utilize a characteristic, conserved spliced leader, SL1, as well as variants that are employed in the resolution of operons. Here we report the identification of spliced leader trans-splicing in the basal nematode Trichinella spiralis, and show that this nematode does not possess a canonical SL1, but rather has at least 15 distinct spliced leaders, encoded by at least 19 SL RNA genes. The individual spliced leaders vary in both size and primary sequence, showing a much higher degree of diversity compared to other known trans-spliced leaders. In a survey of T. spiralis mRNAs, individual mRNAs were found to be trans-spliced to a number of different spliced leader sequences. These data provide the first indication that the last common ancestor of the phylum Nematoda utilized spliced leader trans-splicing and that the canonical spliced leader, SL1, found in Caenorhabditis elegans, evolved after the divergence of the major nematode clades. This discovery sheds important light on the nature and evolution of mRNA processing in the Nematoda.

| S-EPMC2271357 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data