Browse
Submit Data
Databases
API
Help

Dataset Information

8 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Chemical capping improves template switching and enhances sequencing of small RNAs.

ABSTRACT: Template-switching reverse transcription is widely used in RNA sequencing for low-input and low-quality samples, including RNA from single cells or formalin-fixed paraffin-embedded (FFPE) tissues. Previously, we identified the native eukaryotic mRNA 5' cap as a key structural element for enhancing template switching efficiency. Here, we introduce CapTS-seq, a new strategy for sequencing small RNAs that combines chemical capping and template switching. We probed a variety of non-native synthetic cap structures and found that an unmethylated guanosine triphosphate cap led to the lowest bias and highest efficiency for template switching. Through cross-examination of different nucleotides at the cap position, our data provided unequivocal evidence that the 5' cap acts as a template for the first nucleotide in reverse transcriptase-mediated post-templated addition to the emerging cDNA-a key feature to propel template switching. We deployed CapTS-seq for sequencing synthetic miRNAs, human total brain and liver FFPE RNA, and demonstrated that it consistently improves library quality for miRNAs in comparison with a gold standard template switching-based small RNA-seq kit.

SUBMITTER: Wulf MG

PROVIDER: S-EPMC8754658 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Chemical capping improves template switching and enhances sequencing of small RNAs

Project description:We deployed CapTS-seq for sequencing synthetic miRNAs, human total brain RNA, and liver FFPE RNA, and demonstrated that chemical capping in conjunction with template switching consistently reduces sequencing bias and improves library quality in comparison with commercially available RNA-seq kits. Finally, we showed the simultaneous detection of miRNAs and mRNAs in FFPE derived samples, underscoring the potential of this workflow for dissecting regulatory networks between miRNAs and their target gene transcripts.

2021-09-13 | GSE171049 | GEO

Chemical capping improves template switching and enhances sequencing of small RNAs

Project description:Chemical capping improves template switching and enhances sequencing of small RNAs

| PRJNA718247 | ENA

5'-Terminal chemical capping of spliced leader RNAs.

Project description:Spliced leader (SL) RNA trans-splicing adds a 2,2,7-trimethylguanosine cap (TMG) and a 22-nucleotide sequence, the SL, to the 5' end of mRNAs. Both non-trans-spliced with a monomethylguanosine cap (MMG) and trans-spliced mRNAs co-exist in trans-splicing metazoan cells. Efficient translation of TMG-capped mRNAs in nematodes requires a defined core of nucleotides within the SL sequence. Here we present a chemical procedure for the preparation and purification of 5'-terminal capped MMG and TMG wild-type, and mutant 22 nt spliced leader RNAs (GGU/ACUUAAUUACCCAAGUUUGAG) with or without a 3' biotin tag.

| S-EPMC3501006 | biostudies-literature

Template-switching artifacts resemble alternative polyadenylation.

Project description:BACKGROUND:Alternative polyadenylation is commonly examined using cDNA sequencing, which is known to be affected by template-switching artifacts. However, the effects of such template-switching artifacts on alternative polyadenylation are generally disregarded, while alternative polyadenylation artifacts are attributed to internal priming. RESULTS:Here, we analyzed both long-read cDNA sequencing and direct RNA sequencing data of two organisms, generated by different sequencing platforms. We developed a filtering algorithm which takes into consideration that template-switching can be a source of artifactual polyadenylation when filtering out spurious polyadenylation sites. The algorithm outperformed the conventional internal priming filters based on comparison to direct RNA sequencing data. We also showed that the polyadenylation artifacts arise in cDNA sequencing at consecutive stretches of as few as three adenines. There was no substantial difference between the lengths of poly(A) tails at the artifactual and the true transcriptional end sites even though it is expected that internal priming artifacts have shorter poly(A) tails than genuine polyadenylated reads. CONCLUSIONS:Our findings suggest that template switching plays an important role in the generation of spurious polyadenylation and support the need for more rigorous filtering of artifactual polyadenylation sites in cDNA data, or that alternative polyadenylation should be annotated using native RNA sequencing.

| S-EPMC6839120 | biostudies-literature

RNA sequencing uncovers antisense RNAs and novel small RNAs in Streptococcus pyogenes.

Project description:Streptococcus pyogenes is a human pathogen responsible for a wide spectrum of diseases ranging from mild to life-threatening infections. During the infectious process, the temporal and spatial expression of pathogenicity factors is tightly controlled by a complex network of protein and RNA regulators acting in response to various environmental signals. Here, we focus on the class of small RNA regulators (sRNAs) and present the first complete analysis of sRNA sequencing data in S. pyogenes. In the SF370 clinical isolate (M1 serotype), we identified 197 and 428 putative regulatory RNAs by visual inspection and bioinformatics screening of the sequencing data, respectively. Only 35 from the 197 candidates identified by visual screening were assigned a predicted function (T-boxes, ribosomal protein leaders, characterized riboswitches or sRNAs), indicating how little is known about sRNA regulation in S. pyogenes. By comparing our list of predicted sRNAs with previous S. pyogenes sRNA screens using bioinformatics or microarrays, 92 novel sRNAs were revealed, including antisense RNAs that are for the first time shown to be expressed in this pathogen. We experimentally validated the expression of 30 novel sRNAs and antisense RNAs. We show that the expression profile of 9 sRNAs including 2 predicted regulatory elements is affected by the endoribonucleases RNase III and/or RNase Y, highlighting the critical role of these enzymes in sRNA regulation.

| S-EPMC4829319 | biostudies-literature

Phenotypic switching in Pseudomonas brassicacearum involves GacS- and GacA-dependent Rsm small RNAs.

Project description:The plant-beneficial bacterium Pseudomonas brassicacearum forms phenotypic variants in vitro as well as in planta during root colonization under natural conditions. Transcriptome analysis of typical phenotypic variants using microarrays containing coding as well as noncoding DNA fragments showed differential expression of several genes relevant to secondary metabolism and of the small RNA (sRNA) genes rsmX, rsmY, and rsmZ. Naturally occurring mutations in the gacS-gacA system accounted for phenotypic switching, which was characterized by downregulation of antifungal secondary metabolites (2,4-diacetylphloroglucinol and cyanide), indoleacetate, exoenzymes (lipase and protease), and three different N-acyl-homoserine lactone molecules. Moreover, in addition to abrogating these biocontrol traits, gacS and gacA mutations resulted in reduced expression of the type VI secretion machinery, alginate biosynthesis, and biofilm formation. In a gacA mutant, the expression of rsmX was completely abolished, unlike that of rsmY and rsmZ. Overexpression of any of the three sRNAs in the gacA mutant overruled the pleiotropic changes and restored the wild-type phenotypes, suggesting functional redundancy of these sRNAs. In conclusion, our data show that phenotypic switching in P. brassicacearum results from mutations in the gacS-gacA system.

| S-EPMC3298130 | biostudies-literature

Metatranscriptomic analysis of small RNAs present in soybean deep sequencing libraries.

Project description:A large number of small RNAs unrelated to the soybean genome were identified after deep sequencing of soybean small RNA libraries. A metatranscriptomic analysis was carried out to identify the origin of these sequences. Comparative analyses of small interference RNAs (siRNAs) present in samples collected in open areas corresponding to soybean field plantations and samples from soybean cultivated in greenhouses under a controlled environment were made. Different pathogenic, symbiotic and free-living organisms were identified from samples of both growth systems. They included viruses, bacteria and different groups of fungi. This approach can be useful not only to identify potentially unknown pathogens and pests, but also to understand the relations that soybean plants establish with microorganisms that may affect, directly or indirectly, plant health and crop production.

| S-EPMC3392881 | biostudies-other

Comparison of RNA- or LNA-hybrid oligonucleotides in template-switching reactions for high-speed sequencing library preparation.

Project description:BACKGROUND: Analyzing the RNA pool or transcription start sites requires effective means to convert RNA into cDNA libraries for digital expression counting. With current high-speed sequencers, it is necessary to flank the cDNAs with specific adapters. Adding template-switching oligonucleotides to reverse transcription reactions is the most commonly used approach when working with very small quantities of RNA even from single cells. RESULTS: Here we compared the performance of DNA-RNA, DNA-LNA and DNA oligonucleotides in template-switching during nanoCAGE library preparation. Test libraries from rat muscle and HeLa cell RNA were prepared in technical triplicates and sequenced for comparison of the gene coverage and distribution of the reads within transcripts. The DNA-RNA oligonucleotide showed the highest specificity for capped 5' ends of mRNA, whereas the DNA-LNA provided similar gene coverage with more reads falling within exons. CONCLUSIONS: While confirming the cap-specific preference of DNA-RNA oligonucleotides in template-switching reactions, our data indicate that DNA-LNA hybrid oligonucleotides could potentially find other applications in random RNA sequencing.

| S-EPMC3853366 | biostudies-literature

Multi-targeting of viral RNAs with synthetic trans-acting small interfering RNAs enhances plant antiviral resistance.

Project description:RNA interference (RNAi)-based tools are used in multiple organisms to induce antiviral resistance through the sequence-specific degradation of target RNAs by complementary small RNAs. In plants, highly specific antiviral RNAi-based tools include artificial microRNAs (amiRNAs) and synthetic trans-acting small interfering RNAs (syn-tasiRNAs). syn-tasiRNAs have emerged as a promising antiviral tool allowing for the multi-targeting of viral RNAs through the simultaneous expression of several syn-tasiRNAs from a single precursor. Here, we compared in tomato plants the effects of an amiRNA construct expressing a single amiRNA and a syn-tasiRNA construct expressing four different syn-tasiRNAs against Tomato spotted wilt virus (TSWV), an economically important pathogen affecting tomato crops worldwide. Most of the syn-tasiRNA lines were resistant to TSWV, whereas the majority of the amiRNA lines were susceptible and accumulated viral progenies with mutations in the amiRNA target site. Only the two amiRNA lines with higher amiRNA accumulation were resistant, whereas resistance in syn-tasiRNA lines was not exclusive of lines with high syn-tasiRNA accumulation. Collectively, these results suggest that syn-tasiRNAs induce enhanced antiviral resistance because of the combined silencing effect of each individual syn-tasiRNA, which minimizes the possibility that the virus simultaneously mutates all different target sites to fully escape each syn-tasiRNA.

| S-EPMC6899541 | biostudies-literature

Formation of template-switching artifacts by linear amplification.

Project description:Linear amplification is a method of synthesizing single-stranded DNA from either a single-stranded DNA or one strand of a double-stranded DNA. In this protocol, molecules of a single primer DNA are extended by multiple rounds of DNA synthesis at high temperature using thermostable DNA polymerases. Although linear amplification generates the intended full-length single-stranded product, it is more efficient over single-stranded templates than double-stranded templates. We analyzed linear amplification over single- or double-stranded mouse H-ras DNA (exon 1-2 region). The single-stranded H-ras template yielded only the intended product. However, when the double-stranded template was used, additional artifact products were observed. Increasing the concentration of the double-stranded template produced relatively higher amounts of these artifact products. One of the artifact DNA bands could be mapped and analyzed by sequencing. It contained three template-switching products. These DNAs were formed by incomplete DNA strand extension over the template strand, followed by switching to the complementary strand at a specific Ade nucleotide within a putative hairpin sequence, from which DNA synthesis continued over the complementary strand.

| S-EPMC2563923 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data