Dataset Information

Genome-wide association studies identify two novel BMP15 mutations responsible for an atypical hyperprolificacy phenotype in sheep.

ABSTRACT: Some sheep breeds are naturally prolific, and they are very informative for the studies of reproductive genetics and physiology. Major genes increasing litter size (LS) and ovulation rate (OR) were suspected in the French Grivette and the Polish Olkuska sheep populations, respectively. To identify genetic variants responsible for the highly prolific phenotype in these two breeds, genome-wide association studies (GWAS) followed by complementary genetic and functional analyses were performed. Highly prolific ewes (cases) and normal prolific ewes (controls) from each breed were genotyped using the Illumina OvineSNP50 Genotyping Beadchip. In both populations, an X chromosome region, close to the BMP15 gene, harbored clusters of markers with suggestive evidence of association at significance levels between 1E(-05) and 1E(-07). The BMP15 candidate gene was then sequenced, and two novel non-conservative mutations called FecX(Gr) and FecX(O) were identified in the Grivette and Olkuska breeds, respectively. The two mutations were associated with the highly prolific phenotype (p FecX (Gr) = 5.98E(-06) and p FecX(O) = 2.55E(-08)). Homozygous ewes for the mutated allele showed a significantly increased prolificacy (FecX(Gr)/FecX(Gr), LS = 2.50 ± 0.65 versus FecX(+)/FecX(Gr), LS = 1.93 ± 0.42, p<1E(-03) and FecX(O)/FecX(O), OR = 3.28 ± 0.85 versus FecX(+)/FecX(O), OR = 2.02 ± 0.47, p<1E(-03)). Both mutations are located in very well conserved motifs of the protein and altered the BMP15 signaling activity in vitro using a BMP-responsive luciferase test in COV434 granulosa cells. Thus, we have identified two novel mutations in the BMP15 gene associated with increased LS and OR. Notably, homozygous FecX(Gr)/FecX(Gr) Grivette and homozygous FecX(O)/FecX(O) Olkuska ewes are hyperprolific in striking contrast with the sterility exhibited by all other known homozygous BMP15 mutations. Our results bring new insights into the key role played by the BMP15 protein in ovarian function and could contribute to a better understanding of the pathogenesis of women's fertility disorders.

SUBMITTER: Demars J

PROVIDER: S-EPMC3636084 | biostudies-literature | 2013 Apr

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Genome-wide association studies identify two novel BMP15 mutations responsible for an atypical hyperprolificacy phenotype in sheep.

Demars Julie J Fabre Stéphane S Sarry Julien J Rossetti Raffaella R Gilbert Hélène H Persani Luca L Tosser-Klopp Gwenola G Mulsant Philippe P Nowak Zuzanna Z Drobik Wioleta W Martyniuk Elzbieta E Bodin Loys L

PLoS genetics 20130425 4

Some sheep breeds are naturally prolific, and they are very informative for the studies of reproductive genetics and physiology. Major genes increasing litter size (LS) and ovulation rate (OR) were suspected in the French Grivette and the Polish Olkuska sheep populations, respectively. To identify genetic variants responsible for the highly prolific phenotype in these two breeds, genome-wide association studies (GWAS) followed by complementary genetic and functional analyses were performed. High ...[more]

PMID: 23637641

Similar Datasets

Project description:BACKGROUND:Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified. METHODS:Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information. RESULTS:A total of nine different mutations were identified: IVS1-16C?>?A, c.305C?>?T/p.(A102V), c.395G?>?A/p.(R132H), c.736C?>?T/p.(P246S), c.886(-10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_Ala388del), c.1222G?>?T/p.(D408Y), c.1496G?>?A/p.(R499H) and c.1540C?>?T/p.(P514S); two novel mutations in SLC5A2, c.1222G?>?T/p.(D408Y) and c.1496G?>?A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6?g/d. CONCLUSION:We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C?>?A and c.886(-10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.

Dataset Information

Genome-wide association studies identify two novel BMP15 mutations responsible for an atypical hyperprolificacy phenotype in sheep.

Publications

Genome-wide association studies identify two novel BMP15 mutations responsible for an atypical hyperprolificacy phenotype in sheep.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets