Dataset Information

Mutations in a novel factor, glomulin, are responsible for glomuvenous malformations ("glomangiomas").

ABSTRACT: Glomuvenous malformations (GVMs) are cutaneous venous lesions characterized by the presence of smooth-muscle--like glomus cells in the media surrounding distended vascular lumens. We have shown that heritable GVMs link to a 4--6-cM region in chromosome 1p21-22. We also identified linkage disequilibrium that allowed a narrowing of this VMGLOM locus to 1.48 Mb. Herein, we report the identification of the mutated gene, glomulin, localized on the basis of the YAC and PAC maps. An incomplete cDNA sequence for glomulin had previously been designated "FAP48," for "FKBP-associated protein of 48 kD." The complete cDNA for glomulin contains an open reading frame of 1,785 nt encoding a predicted protein of 68 kD. The gene consists of 19 exons in which we identified 14 different germline mutations in patients with GVM. In addition, we found a somatic "second hit" mutation in affected tissue of a patient with an inherited genomic deletion. Since all but one of the mutations result in premature stop codons, and since the localized nature of the lesions could be explained by Knudson's two-hit model, GVMs are likely caused by complete loss of function of glomulin. The abnormal phenotype of vascular smooth-muscle cells (VSMCs) in GVMs suggests that glomulin plays an important role in differentiation of these cells--and, thereby, in vascular morphogenesis--especially in cutaneous veins.

SUBMITTER: Brouillard P

PROVIDER: S-EPMC379115 | biostudies-literature | 2002 Apr

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Mutations in a novel factor, glomulin, are responsible for glomuvenous malformations ("glomangiomas").

Brouillard Pascal P Boon Laurence M LM Mulliken John B JB Enjolras Odile O Ghassibé Michella M Warman Matthew L ML Tan O T OT Olsen Bjorn R BR Vikkula Miikka M

American journal of human genetics 20020213 4

Glomuvenous malformations (GVMs) are cutaneous venous lesions characterized by the presence of smooth-muscle--like glomus cells in the media surrounding distended vascular lumens. We have shown that heritable GVMs link to a 4--6-cM region in chromosome 1p21-22. We also identified linkage disequilibrium that allowed a narrowing of this VMGLOM locus to 1.48 Mb. Herein, we report the identification of the mutated gene, glomulin, localized on the basis of the YAC and PAC maps. An incomplete cDNA seq ...[more]

PMID: 11845407

Similar Datasets

Project description:BACKGROUND:Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified. METHODS:Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information. RESULTS:A total of nine different mutations were identified: IVS1-16C?>?A, c.305C?>?T/p.(A102V), c.395G?>?A/p.(R132H), c.736C?>?T/p.(P246S), c.886(-10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_Ala388del), c.1222G?>?T/p.(D408Y), c.1496G?>?A/p.(R499H) and c.1540C?>?T/p.(P514S); two novel mutations in SLC5A2, c.1222G?>?T/p.(D408Y) and c.1496G?>?A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6?g/d. CONCLUSION:We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C?>?A and c.886(-10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.

Dataset Information

Mutations in a novel factor, glomulin, are responsible for glomuvenous malformations ("glomangiomas").

Publications

Mutations in a novel factor, glomulin, are responsible for glomuvenous malformations ("glomangiomas").

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets