Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Multidimensional reaction screening for photochemical transformations as a tool for discovering new chemotypes.

ABSTRACT: We have developed an automated photochemical microfluidics platform that integrates a 1 kW high-pressure Hg vapor lamp and allows for analytical pulse flow or preparative continuous flow reactions. Herein, we will discuss the use of this platform toward the discovery of new chemotypes through multidimensional reaction screening. We will highlight the ability to discretely control wavelengths with optical filters, allowing for control of reaction outcomes.

SUBMITTER: Martin VI

PROVIDER: S-EPMC4017617 | biostudies-literature | 2014 May

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Multidimensional reaction screening for photochemical transformations as a tool for discovering new chemotypes.

Martin Véronique I VI Goodell John R JR Ingham Oscar J OJ Porco John A JA Beeler Aaron B AB

The Journal of organic chemistry 20140416 9

We have developed an automated photochemical microfluidics platform that integrates a 1 kW high-pressure Hg vapor lamp and allows for analytical pulse flow or preparative continuous flow reactions. Herein, we will discuss the use of this platform toward the discovery of new chemotypes through multidimensional reaction screening. We will highlight the ability to discretely control wavelengths with optical filters, allowing for control of reaction outcomes. ...[more]

PMID: 24697145

Similar Datasets

Ultra-large library docking for discovering new chemotypes.

Project description:Despite intense interest in expanding chemical space, libraries containing hundreds-of-millions to billions of diverse molecules have remained inaccessible. Here we investigate structure-based docking of 170 million make-on-demand compounds from 130 well-characterized reactions. The resulting library is diverse, representing over 10.7 million scaffolds that are otherwise unavailable. For each compound in the library, docking against AmpC β-lactamase (AmpC) and the D4 dopamine receptor were simulated. From the top-ranking molecules, 44 and 549 compounds were synthesized and tested for interactions with AmpC and the D4 dopamine receptor, respectively. We found a phenolate inhibitor of AmpC, which revealed a group of inhibitors without known precedent. This molecule was optimized to 77 nM, which places it among the most potent non-covalent AmpC inhibitors known. Crystal structures of this and other AmpC inhibitors confirmed the docking predictions. Against the D4 dopamine receptor, hit rates fell almost monotonically with docking score, and a hit-rate versus score curve predicted that the library contained 453,000 ligands for the D4 dopamine receptor. Of 81 new chemotypes discovered, 30 showed submicromolar activity, including a 180-pM subtype-selective agonist of the D4 dopamine receptor.

| S-EPMC6383769 | biostudies-literature

Discovering General Multidimensional Associations.

Project description:When two variables are related by a known function, the coefficient of determination (denoted R2) measures the proportion of the total variance in the observations explained by that function. For linear relationships, this is equal to the square of the correlation coefficient, ρ. When the parametric form of the relationship is unknown, however, it is unclear how to estimate the proportion of explained variance equitably--assigning similar values to equally noisy relationships. Here we demonstrate how to directly estimate a generalised R2 when the form of the relationship is unknown, and we consider the performance of the Maximal Information Coefficient (MIC)--a recently proposed information theoretic measure of dependence. We show that our approach behaves equitably, has more power than MIC to detect association between variables, and converges faster with increasing sample size. Most importantly, our approach generalises to higher dimensions, estimating the strength of multivariate relationships (Y against A, B, …) as well as measuring association while controlling for covariates (Y against X controlling for C). An R package named matie ("Measuring Association and Testing Independence Efficiently") is available (http://cran.r-project.org/web/packages/matie/).

| S-EPMC4798755 | biostudies-literature

A New DEMO Modelling Tool that Facilitates Model Transformations

Project description:The age of digitization requires rapid design and re-design of enterprises. Rapid changes can be realized using conceptual modelling. The design and engineering methodology for organizations (DEMO) is an established modelling method for representing the organization domain of an enterprise. However, heterogeneity in enterprise design stakeholders generally demand for transformations between conceptual modelling languages. Specifically, in the case of DEMO, a transformation into business process modelling and notation (BPMN) models is desirable to account to both, the semantic sound foundation of the DEMO models, and the wide adoption of the de-facto industry standard BPMN. Model transformation can only be efficiently applied if tool support is available. Our research starts with a state-of-the-art analysis, comparing existing DEMO modelling tools. Using a design science research approach, our main contribution is the development of a DEMO modelling tool on the ADOxx platform. One of the main features of our tool is that it addresses stakeholder heterogeneity by enabling transformation of a DEMO organization construction diagram (OCD) into a BPMN collaboration diagram. A demonstration case shows the feasibility of our newly developed tool.

| S-EPMC7254542 | biostudies-literature

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction.

Project description:The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or β-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.

| S-EPMC8835054 | biostudies-literature

Reaction discovery using microfluidic-based multidimensional screening of polycyclic iminium ethers.

Project description:Polycyclic iminium ethers are ambident electrophilic intermediates that react with a range of nucleophiles in a highly condition-dependent manner to afford densely functionalized lactams. In an effort to expand the scope of reactivity and assist in the generation of new chemotypes from these intermediates, several iminium ethers were subjected to reaction screening using an automated microfluidics reaction platform. Application of this approach led to the discovery of several interesting reaction pathways involving the iminium ether intermediates that will be described.

| S-EPMC2846649 | biostudies-literature

Vibronic coherence evolution in multidimensional ultrafast photochemical processes.

Project description:The complex choreography of electronic, vibrational, and vibronic couplings used by photoexcited molecules to transfer energy efficiently is remarkable, but an unambiguous description of the temporally evolving vibronic states governing these processes has proven experimentally elusive. We use multidimensional electronic-vibrational spectroscopy to identify specific time-dependent excited state vibronic couplings involving multiple electronic states, high-frequency vibrations, and low-frequency vibrations which participate in ultrafast intersystem crossing and subsequent relaxation of a photoexcited transition metal complex. We discover an excited state vibronic mechanism driving long-lived charge separation consisting of an initial electronically-localized vibrational wavepacket which triggers delocalization onto two charge transfer states after propagating for ~600 femtoseconds. Electronic delocalization consequently occurs through nonadiabatic internal conversion driven by a 50 cm-1 coupling resulting in vibronic coherence transfer lasting for ~1 picosecond. This study showcases the power of multidimensional electronic-vibrational spectroscopy to elucidate complex, non-equilibrium energy and charge transfer mechanisms involving multiple molecular coordinates.

| S-EPMC6901526 | biostudies-literature

Development of an automated microfluidic reaction platform for multidimensional screening: reaction discovery employing bicyclo[3.2.1]octanoid scaffolds.

Project description:An automated, silicon-based microreactor system has been developed for rapid, low-volume, multidimensional reaction screening. Use of the microfluidic platform to identify transformations of densely functionalized bicyclo[3.2.1]octanoid scaffolds will be described.

| S-EPMC2976622 | biostudies-literature

Photochemical Hexadehydro-Diels-Alder Reaction.

Project description:We demonstrate that the hexadehydro-Diels-Alder (HDDA) cycloisomerization reaction to produce reactive benzyne derivatives can be initiated photochemically. As with the thermal variant of the HDDA process, the reactive intermediates are formed in the absence of reagents or the resulting byproducts required for the generation of benzynes by traditional methods. This photo-HDDA (or hν-HDDA) reaction occurs at much lower temperatures (including even at -70 °C) than the thermal HDDA, but the benzynes produced behave in the same fashion with respect to their trapping reactions, suggesting they are of the same electronic state.

| S-EPMC6348472 | biostudies-literature

Mechanistic insights into chemical and photochemical transformations of bismuth vanadate photoanodes.

Project description:Artificial photosynthesis relies on the availability of semiconductors that are chemically stable and can efficiently capture solar energy. Although metal oxide semiconductors have been investigated for their promise to resist oxidative attack, materials in this class can suffer from chemical and photochemical instability. Here we present a methodology for evaluating corrosion mechanisms and apply it to bismuth vanadate, a state-of-the-art photoanode. Analysis of changing morphology and composition under solar water splitting conditions reveals chemical instabilities that are not predicted from thermodynamic considerations of stable solid oxide phases, as represented by the Pourbaix diagram for the system. Computational modelling indicates that photoexcited charge carriers accumulated at the surface destabilize the lattice, and that self-passivation by formation of a chemically stable surface phase is kinetically hindered. Although chemical stability of metal oxides cannot be assumed, insight into corrosion mechanisms aids development of protection strategies and discovery of semiconductors with improved stability.

| S-EPMC4935965 | biostudies-literature

Photochemical Transformations of Peptides Containing the N-(2-Selenoethyl)glycine Moiety

Project description: Not available

| S-EPMC11007844 | biostudies-literature