Dataset Information

Sox2 promotes malignancy in glioblastoma by regulating plasticity and astrocytic differentiation.

ABSTRACT: The high-mobility group-box transcription factor sex-determining region Y-box 2 (Sox2) is essential for the maintenance of stem cells from early development to adult tissues. Sox2 can reprogram differentiated cells into pluripotent cells in concert with other factors and is overexpressed in various cancers. In glioblastoma (GBM), Sox2 is a marker of cancer stemlike cells (CSCs) in neurosphere cultures and is associated with the proneural molecular subtype. Here, we report that Sox2 expression pattern in GBM tumors and patient-derived mouse xenografts is not restricted to a small percentage of cells and is coexpressed with various lineage markers, suggesting that its expression extends beyond CSCs to encompass more differentiated neoplastic cells across molecular subtypes. Employing a CSC derived from a patient with GBM and isogenic differentiated cell model, we show that Sox2 knockdown in the differentiated state abolished dedifferentiation and acquisition of CSC phenotype. Furthermore, Sox2 deficiency specifically impaired the astrocytic component of a biphasic gliosarcoma xenograft model while allowing the formation of tumors with sarcomatous phenotype. The expression of genes associated with stem cells and malignancy were commonly downregulated in both CSCs and serum-differentiated cells on Sox2 knockdown. Genes previously shown to be associated with pluripontency and CSCs were only affected in the CSC state, whereas embryonic stem cell self-renewal genes and cytokine signaling were downregulated, and the Wnt pathway activated in differentiated Sox2-deficient cells. Our results indicate that Sox2 regulates the expression of key genes and pathways involved in GBM malignancy, in both cancer stemlike and differentiated cells, and maintains plasticity for bidirectional conversion between the two states, with significant clinical implications.

SUBMITTER: Berezovsky AD

PROVIDER: S-EPMC4094829 | biostudies-literature | 2014 Mar

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Sox2 promotes malignancy in glioblastoma by regulating plasticity and astrocytic differentiation.

Berezovsky Artem D AD Poisson Laila M LM Cherba David D Webb Craig P CP Transou Andrea D AD Lemke Nancy W NW Hong Xin X Hasselbach Laura A LA Irtenkauf Susan M SM Mikkelsen Tom T deCarvalho Ana C AC

Neoplasia (New York, N.Y.) 20140301 3

The high-mobility group-box transcription factor sex-determining region Y-box 2 (Sox2) is essential for the maintenance of stem cells from early development to adult tissues. Sox2 can reprogram differentiated cells into pluripotent cells in concert with other factors and is overexpressed in various cancers. In glioblastoma (GBM), Sox2 is a marker of cancer stemlike cells (CSCs) in neurosphere cultures and is associated with the proneural molecular subtype. Here, we report that Sox2 expression pa ...[more]

PMID: 24726753

Similar Datasets

Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen). Control Glioblastoma cells cultured as neurospheres and monolayer early passage are compared to multiple shRNA SOX2 knockdown and multiple miR knockdown cell cultures. A total of 8 samples are analyzed for significant fold change genes identifying gene-gene interactions associated with the SOX2 knockdown. High fold change genes are grouped in lists to be analyzed for network-pathway enrichment. Overlap of significant gene list for each method were analyzed.

Dataset Information

Sox2 promotes malignancy in glioblastoma by regulating plasticity and astrocytic differentiation.

Publications

Sox2 promotes malignancy in glioblastoma by regulating plasticity and astrocytic differentiation.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets