Dataset Information

FoxM1 Promotes Stemness and Radio-Resistance of Glioblastoma by Regulating the Master Stem Cell Regulator Sox2.

ABSTRACT: Glioblastoma (GBM) is the most aggressive and most lethal brain tumor. As current standard therapy consisting of surgery and chemo-irradiation provides limited benefit for GBM patients, novel therapeutic options are urgently required. Forkhead box M1 (FoxM1) transcription factor is an oncogenic regulator that promotes the proliferation, survival, and treatment resistance of various human cancers. The roles of FoxM1 in GBM remain incompletely understood, due in part to pleotropic nature of the FoxM1 pathway. Here, we show the roles of FoxM1 in GBM stem cell maintenance and radioresistance. ShRNA-mediated FoxM1 inhibition significantly impeded clonogenic growth and survival of patient-derived primary GBM cells with marked downregulation of Sox2, a master regulator of stem cell phenotype. Ectopic expression of Sox2 partially rescued FoxM1 inhibition-mediated effects. Conversely, FoxM1 overexpression upregulated Sox2 expression and promoted clonogenic growth of GBM cells. These data, with a direct binding of FoxM1 in the Sox2 promoter region in GBM cells, suggest that FoxM1 regulates stemness of primary GBM cells via Sox2. We also found significant increases in FoxM1 and Sox2 expression in GBM cells after irradiation both in vitro and in vivo orthotopic tumor models. Notably, genetic or a small-molecule FoxM1 inhibitor-mediated FoxM1 targeting significantly sensitized GBM cells to irradiation, accompanying with Sox2 downregulation. Finally, FoxM1 inhibition combined with irradiation in a patient GBM-derived orthotopic model significantly impeded tumor growth and prolonged the survival of tumor bearing mice. Taken together, these results indicate that the FoxM1-Sox2 signaling axis promotes clonogenic growth and radiation resistance of GBM, and suggest that FoxM1 targeting combined with irradiation is a potentially effective therapeutic approach for GBM.

SUBMITTER: Lee Y

PROVIDER: S-EPMC4596841 | biostudies-literature | 2015

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

FoxM1 Promotes Stemness and Radio-Resistance of Glioblastoma by Regulating the Master Stem Cell Regulator Sox2.

Lee Yeri Y Kim Kang Ho KH Kim Dong Geon DG Cho Hee Jin HJ Kim Yeonghwan Y Rheey Jinguen J Shin Kayoung K Seo Yun Jee YJ Choi Yeon-Sook YS Lee Jung-Il JI Lee Jeongwu J Joo Kyeung Min KM Nam Do-Hyun DH

PloS one 20151007 10

Glioblastoma (GBM) is the most aggressive and most lethal brain tumor. As current standard therapy consisting of surgery and chemo-irradiation provides limited benefit for GBM patients, novel therapeutic options are urgently required. Forkhead box M1 (FoxM1) transcription factor is an oncogenic regulator that promotes the proliferation, survival, and treatment resistance of various human cancers. The roles of FoxM1 in GBM remain incompletely understood, due in part to pleotropic nature of the Fo ...[more]

PMID: 26444992

Similar Datasets

Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen). Control Glioblastoma cells cultured as neurospheres and monolayer early passage are compared to multiple shRNA SOX2 knockdown and multiple miR knockdown cell cultures. A total of 8 samples are analyzed for significant fold change genes identifying gene-gene interactions associated with the SOX2 knockdown. High fold change genes are grouped in lists to be analyzed for network-pathway enrichment. Overlap of significant gene list for each method were analyzed.

Dataset Information

FoxM1 Promotes Stemness and Radio-Resistance of Glioblastoma by Regulating the Master Stem Cell Regulator Sox2.

Publications

FoxM1 Promotes Stemness and Radio-Resistance of Glioblastoma by Regulating the Master Stem Cell Regulator Sox2.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets