Inhibition of glioblastoma malignancy by Lgl1.
Ontology highlight
ABSTRACT:
SUBMITTER: Gont A
PROVIDER: S-EPMC4294391 | biostudies-literature | 2014 Nov
REPOSITORIES: biostudies-literature
Publications
Inhibition of glioblastoma malignancy by Lgl1.
Gont Alexander A Hanson Jennifer E L JE Lavictoire Sylvie J SJ Daneshmand Manijeh M Nicholas Garth G Woulfe John J Kassam Amin A Da Silva Vasco F VF Lorimer Ian A J IA
Oncotarget 20141101 22
lethal giant larvae (lgl) was first identified as a tumor suppressor in Drosophila, where its loss repressed the differentiation and promoted the invasion of neuroblasts, the Drosophila equivalent of the neural stem cell. Recently we have shown that a human homolog of Lgl, Lgl1 (LLGL1), is constitutively phosphorylated and inactivated in glioblastoma cells; this occurs as a downstream consequence of PTEN loss, one of the most frequent genetic events in glioblastoma. Here we have investigated the ...[more]
Similar Datasets
Project description:The protein Lgl1 is a key regulator of cell polarity. We previously showed that Lgl1 is inactivated by hyperphosphorylation in glioblastoma as a consequence of PTEN tumour suppressor loss and aberrant activation of the PI 3-kinase pathway; this contributes to glioblastoma pathogenesis both by promoting invasion and repressing glioblastoma cell differentiation. Lgl1 is phosphorylated by atypical protein kinase C that has been activated by binding to a complex of the scaffolding protein Par6 and active, GTP-bound Rac. The specific Rac guanine nucleotide exchange factors that generate active Rac to promote Lgl1 hyperphosphorylation in glioblastoma are unknown. We used CRISPR/Cas9 to knockout PREX1, a PI 3-kinase pathway-responsive Rac guanine nucleotide exchange factor, in patient-derived glioblastoma cells. Knockout cells had reduced Lgl1 phosphorylation, which was reversed by re-expressing PREX1. They also had reduced motility and an altered phenotype suggestive of partial neuronal differentiation; consistent with this, RNA-seq analyses identified sets of PREX1-regulated genes associated with cell motility and neuronal differentiation. PREX1 knockout in glioblastoma cells from a second patient did not affect Lgl1 phosphorylation. This was due to overexpression of a short isoform of the Rac guanine nucleotide exchange factor TIAM1; knockdown of TIAM1 in these PREX1 knockout cells reduced Lgl1 phosphorylation. These data show that PREX1 links aberrant PI 3-kinase signaling to Lgl1 phosphorylation in glioblastoma, but that TIAM1 is also to fill this role in a subset of patients. This redundancy between PREX1 and TIAM1 is only partial, as motility was impaired in PREX1 knockout cells from both patients.
| S-EPMC8551657 | biostudies-literature
Project description:Epigenetic modifications control gene expression by regulating the access of nuclear proteins to their target DNA and have been implicated in both normal cell differentiation and oncogenic transformation. Epigenetic abnormalities can occur both as a cause and as a consequence of cancer. Oncogenic transformation can deeply alter the epigenetic information enclosed in the pattern of DNA methylation or histone modifications. In addition, in some cancers epigenetic dysfunctions can drive oncogenic transformation. Growing evidence emphasizes the interplay between metabolic disturbances, epigenomic changes and cancer, i.e., mutations in the metabolic enzymes SDH, FH, and IDH may contribute to cancer development. Epigenetic-based mechanisms are reversible and the possibility of "resetting" the abnormal cancer epigenome by applying pharmacological or genetic strategies is an attractive, novel approach. Gliomas are incurable with all current therapeutic approaches and new strategies are urgently needed. Increasing evidence suggests the role of epigenetic events in development and/or progression of gliomas. In this review, we summarize current data on the occurrence and significance of mutations in the epigenetic and metabolic enzymes in pathobiology of gliomas. We discuss emerging therapies targeting specific epigenetic modifications or chromatin modifying enzymes either alone or in combination with other treatment regimens.
| S-EPMC3795382 | biostudies-literature
Project description:The protein Lgl has key roles in the regulation of cell polarity. We have shown that Lgl is inactivated by hyperphosphorylation in glioblastoma as a consequence of PTEN loss and aberrant activation of the PI 3-kinase pathway; this contributes to glioblastoma pathogenesis both by promoting invasion and repressing glioblastoma cell differentiation. Lgl is phosphorylated by atypical protein kinase C in a complex with Par6 and either activated Cdc42 or activated Rac. Here we have investigated the role of specific Rac guanine nucleotide exchange factors in Lgl hyperphosphorylation in glioblastoma. We used CRISPR/Cas9 to knockout PREX1, a PI 3-kinase pathway-responsive Rac guanine nucleotide exchange factor that is overexpressed in glioblastoma. Knockout of PREX1 in patient-derived glioblastoma cells resulted in a reduction in Lgl phosphorylation and this could be reversed by re-expressing PREX1. PREX1 knockout cells showed reduced motility and altered phenotype suggestive of partial neuronal differentiation; consistent with this, RNA-seq analyses of these cells identified sets of PREX1-regulated genes with roles in promoting cell motility and repressing neuronal differentiation. Knockout of PREX1 in glioblastoma cells derived from a second patient did not affect Lgl phosphorylation. These cells overexpressed a short isoform of the Rac guanine nucleotide exchange factor TIAM1; knockdown of TIAM1 in PREX1-knockout cells from this patient reduced Lgl phosphorylation. These data show that PREX1 links aberrant PI 3-kinase to Lgl phosphorylation in glioblastoma, but that TIAM1 can also promote Lgl phosphorylation in a subset of patients. While this shows redundant mechanisms for Lgl phosphorylation, PREX1 appears to have a non-redundant role in glioblastoma cell motility, as this was impaired in PREX1 knockout cells from both patients.
2021-08-23 | GSE162783 | GEO
Project description:Glioblastoma (GBM) is the most common and devastating primary cancer of the central nervous system in adults. High grade gliomas are able to modify and respond to the brain microenvironment. When GBM tumors infiltrate the Subventricular zone (SVZ) they have a more aggressive clinical presentation than SVZ-distal tumors. We suggest that cerebrospinal fluid (CSF) contact contributes to enhance GBM malignant characteristics in these tumors. We evaluated the impact of human CSF on GBM, performing a transcriptome analysis on human primary GBM cells exposed to CSF to measure changes in gene expression profile and their clinical relevance on disease outcome. In addition we evaluated the proliferation and migration changes of CSF-exposed GBM cells in vitro and in vivo. CSF induced transcriptomic changes in pathways promoting cell malignancy, such as apoptosis, survival, cell motility, angiogenesis, inflammation, and glucose metabolism. A genetic signature extracted from the identified transcriptional changes in response to CSF proved to be predictive of GBM patient survival using the TCGA database. Furthermore, CSF induced an increase in viability, proliferation rate, and self-renewing capacity, as well as the migratory capabilities of GBM cells in vitro. In vivo, GBM cells co-injected with human CSF generated larger and more proliferative tumors compared to controls. Taken together, these results provide direct evidence that CSF is a key player in determining tumor growth and invasion through the activation of complex gene expression patterns characteristic of a malignant phenotype. These findings have diagnostic and therapeutic implications for GBM patients. The changes induced by CSF contact might play a role in the increased malignancy of SVZ-proximal GBM.
| S-EPMC7969659 | biostudies-literature
Project description:BackgroundGlioblastoma is one of the most devastating cancer worldwide based on its locally aggressive behavior and because it cannot be cured by current therapies. Defects in alternative splicing process are frequent in cancer. Recently, we demonstrated that dysregulation of the spliceosome is directly associated with glioma development, progression, and aggressiveness.MethodsDifferent human cohorts and a dataset from different glioma mouse models were analyzed to determine the mutation frequency as well as the gene and protein expression levels between tumor and control samples of the splicing-factor-3B-subunit-1 (SF3B1), an essential and druggable spliceosome component. SF3B1 expression was also explored at the single-cell level across all cell subpopulations and transcriptomic programs. The association of SF3B1 expression with relevant clinical data (e.g., overall survival) in different human cohorts was also analyzed. Different functional (proliferation/migration/tumorspheres and colonies formation/VEGF secretion/apoptosis) and mechanistic (gene expression/signaling pathways) assays were performed in three different glioblastomas cell models (human primary cultures and cell lines) in response to SF3B1 blockade (using pladienolide B treatment). Moreover, tumor progression and formation were monitored in response to SF3B1 blockade in two preclinical xenograft glioblastoma mouse models.ResultsOur data provide novel evidence demonstrating that the splicing-factor-3B-subunit-1 (SF3B1, an essential and druggable spliceosome component) is low-frequency mutated in human gliomas (~ 1 %) but widely overexpressed in glioblastoma compared with control samples from the different human cohorts and mouse models included in the present study, wherein SF3B1 levels are associated with key molecular and clinical features (e.g., overall survival, poor prognosis and/or drug resistance). Remarkably, in vitro and in vivo blockade of SF3B1 activity with pladienolide B drastically altered multiple glioblastoma pathophysiological processes (i.e., reduction in proliferation, migration, tumorspheres formation, VEGF secretion, tumor initiation and increased apoptosis) likely by suppressing AKT/mTOR/ß-catenin pathways, and an imbalance of BCL2L1 splicing.ConclusionsTogether, we highlight SF3B1 as a potential diagnostic and prognostic biomarker and an efficient pharmacological target in glioblastoma, offering a clinically relevant opportunity worth to be explored in humans.
| S-EPMC8793262 | biostudies-literature
Project description:The tumor microenvironment has a dynamic and usually cancer-promoting function during all tumorigenic steps. Glioblastoma (GBM) is a fatal tumor of the central nervous system, in which a substantial number of non-tumoral infiltrated cells can be found. Astrocytes neighboring these tumor cells have a particular reactive phenotype and can enhance GBM malignancy by inducing aberrant cell proliferation and invasion. The tumor suppressor p53 has a potential non-cell autonomous function by modulating the expression of secreted proteins that influence neighbor cells. In this work, we investigated the role of p53 on the crosstalk between GBM cells and astrocytes. We show that extracellular matrix (ECM) from p53(+/-) astrocytes is richer in laminin and fibronectin, compared with ECM from p53(+/+) astrocytes. In addition, ECM from p53(+/-) astrocytes increases the survival and the expression of mesenchymal markers in GBM cells, which suggests haploinsufficient phenotype of the p53(+/-) microenvironment. Importantly, conditioned medium from GBM cells blocks the expression of p53 in p53(+/+) astrocytes, even when DNA was damaged. These results suggest that GBM cells create a dysfunctional microenvironment based on the impairment of p53 expression that in turns exacerbates tumor endurance.
| S-EPMC4216902 | biostudies-literature
Project description:Constitutively activated STAT3 plays an essential role in the initiation, progression, maintenance, malignancy, and drug resistance of cancer, including glioblastoma, suggesting that STAT3 is a potential therapeutic target for cancer therapy. We recently identified ODZ10117 as a small molecule inhibitor of STAT3 and suggested that it may have an effective therapeutic utility for the STAT3-targeted cancer therapy. Here, we demonstrated the therapeutic efficacy of ODZ10117 in glioblastoma by targeting STAT3. ODZ10117 inhibited migration and invasion and induced apoptotic cell death by targeting STAT3 in glioblastoma cells and patient-derived primary glioblastoma cells. In addition, ODZ10117 suppressed stem cell properties in glioma stem cells (GSCs). Finally, the administration of ODZ10117 showed significant therapeutic efficacy in mouse xenograft models of GSCs and glioblastoma cells. Collectively, ODZ10117 is a promising therapeutic candidate for glioblastoma by targeting STAT3.
| S-EPMC7140655 | biostudies-literature
Project description:OBJECTIVES:The long-noncoding RNAs (lncRNAs) are identified as new crucial regulators of diverse cellular processes in glioblastoma (GBM) tissues. However, the expression pattern and biological function of lncRNAs remain largely unknown. Here, for the first time, the effects of lncRNA lymphoid enhancer-binding factor 1 antisense RNA 1 (LEF1-AS1) on GBM progression both in vitro and in vivo are investigated. MATERIALS AND METHODS:Expression profiles of LEF1-AS1 in GBM specimens were investigated by bioinformatics analyses. LEF1-AS1 expression in GBM tissues was detected using a quantitative polymerase chain reaction. LEF1-AS1 expression was inhibited by transfecting the LEF1-AS1-specific small interfering RNAs (siRNAs) and stable cell lines established were inhibited by transfecting si-LEF1-AS1 viruses. The Cell Counting Kit-8, ethynyl deoxyuridine, and colony formation assay were used to examine proliferation function. The flow cytometry detected cell-cycle change and apoptosis. Migration effects were detected by a Transwell assay. The tumor xenografts and immunohistochemistry were performed to evaluate tumor growth in vivo. RESULTS:In this study, LEF1-AS1 expression was found significantly upregulated in GBM specimens compared with normal tissues. The 5-year overall survival in GBM patients from The Cancer Genome Atlas with high expression of LEF1-AS1 was inferior to that with low expression. It was confirmed that expression of LEF1-AS1 was higher in GBM tissues than normal ones. Knockdown of LEF1-AS1 significantly inhibited the malignancy of GBM cells, including proliferation and invasion, and promoted cell apoptosis. The result of Western blot assays indicated that knockdown of LEF1-AS1-mediated tumor suppression in GBM cells may be via the reduction of ERK and Akt/mTOR signaling activities. Finally, the in vivo experiment also demonstrated that knockdown LEF1-AS1 inhibited the growth-promoting effect of LEF1-AS1 of U87 cells. CONCLUSION:Our result indicated that lncRNA LEF1-AS1 acts as an oncogene in GBM and may be a pivotal target for this disease.
| S-EPMC5584905 | biostudies-literature
Project description:The high-mobility group-box transcription factor sex-determining region Y-box 2 (Sox2) is essential for the maintenance of stem cells from early development to adult tissues. Sox2 can reprogram differentiated cells into pluripotent cells in concert with other factors and is overexpressed in various cancers. In glioblastoma (GBM), Sox2 is a marker of cancer stemlike cells (CSCs) in neurosphere cultures and is associated with the proneural molecular subtype. Here, we report that Sox2 expression pattern in GBM tumors and patient-derived mouse xenografts is not restricted to a small percentage of cells and is coexpressed with various lineage markers, suggesting that its expression extends beyond CSCs to encompass more differentiated neoplastic cells across molecular subtypes. Employing a CSC derived from a patient with GBM and isogenic differentiated cell model, we show that Sox2 knockdown in the differentiated state abolished dedifferentiation and acquisition of CSC phenotype. Furthermore, Sox2 deficiency specifically impaired the astrocytic component of a biphasic gliosarcoma xenograft model while allowing the formation of tumors with sarcomatous phenotype. The expression of genes associated with stem cells and malignancy were commonly downregulated in both CSCs and serum-differentiated cells on Sox2 knockdown. Genes previously shown to be associated with pluripontency and CSCs were only affected in the CSC state, whereas embryonic stem cell self-renewal genes and cytokine signaling were downregulated, and the Wnt pathway activated in differentiated Sox2-deficient cells. Our results indicate that Sox2 regulates the expression of key genes and pathways involved in GBM malignancy, in both cancer stemlike and differentiated cells, and maintains plasticity for bidirectional conversion between the two states, with significant clinical implications.
| S-EPMC4094829 | biostudies-literature
Project description:Making use of a previously described isogenic cancer stem cells and serum differentiated cultures we show that Sox2 controls developmental stated specific programs in glioblastoma. Glioblastoma cells were cultured as control and with SOX2 knockdown to identify the scope of SOX2 interactions. The SOX2 knockdown were accomplished using two knockdown technologies. The knockdown cells were compared to controls, early passage, and scrambled controls. For Sox2 knockdown in low passage 10% FBS cells, the following oligonucleotides targeting human SOX2 coding sequence, or non-silencing control sequence, were cloned into BLOCK-iT Pol II miR RNAi expression vectors (Invitrogen), before cell transfection into GBM monolayer cells using Lipofectamine-2000 (Invitrogen): Sox2miRNA1R:5’CCTGTGCATGGGCTGTCTGCGCTGTCAGTCAGTGGCCAAAACAGCGCAGATGCAGCCCATGCAC Sox2miRNA1F:5’TGCTGTGCATGGGCTGCATCTGCGCTGTTTTGGCCACTGACTGACAGCGCAGACAGCC Sox2miRNA2R:5’CCTGAACCCATGGAGAAGAGCCAGTCAGTCAGTGGCCAAAACTGGCTCTTGGCTCCATGGGTTC Sox2miRNA2F:5’TGCTGAACCCATGGAGCCAAGAGCCAGTTTTGGCCACTGACTGACTGGCTCTTCTCCATGGGTT miRNAnegative:5’GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT Sox2 knockdown in neurospheres: GIPZ Lentiviral shRNAmir constructs targeting human Sox2 (clones V3LHS_404430 and V3LHS_404432) and non-silencing control (RHS4346) were obtained (Thermo Scientific Open Biosystems) and lentivirus were prepared according to the manufacturer’s instructions. Sox2 ectopic expression: Sox2 cDNA was subcloned from pCMV6-XL5-NM_002106.2 (Origene) into pcDNA 3.1 mammalian expression vector (Invitrogen), under control of constitutive CMV promoter. Plasmid DNA constructs were stably transfected into GBM monolayer cells using Lipofectamine-2000 (Invitrogen). Control Glioblastoma cells cultured as neurospheres and monolayer early passage are compared to multiple shRNA SOX2 knockdown and multiple miR knockdown cell cultures. A total of 8 samples are analyzed for significant fold change genes identifying gene-gene interactions associated with the SOX2 knockdown. High fold change genes are grouped in lists to be analyzed for network-pathway enrichment. Overlap of significant gene list for each method were analyzed.
| S-ECPF-GEOD-51441 | biostudies-other