Identification of a novel human rhinovirus C type by antibody capture VIDISCA-454.
Ontology highlight
ABSTRACT:
SUBMITTER: Jazaeri Farsani SM
PROVIDER: S-EPMC4306836 | biostudies-literature | 2015 Jan
REPOSITORIES: biostudies-literature
Publications
Identification of a novel human rhinovirus C type by antibody capture VIDISCA-454.
Jazaeri Farsani Seyed Mohammad SM Oude Munnink Bas B BB Canuti Marta M Deijs Martin M Cotten Matthew M Jebbink Maarten F MF Verhoeven Joost J Kellam Paul P Loens Katherine K Goossens Herman H Ieven Margareta M van der Hoek Lia L
Viruses 20150119 1
Causative agents for more than 30 percent of respiratory infections remain unidentified, suggesting that unknown respiratory pathogens might be involved. In this study, antibody capture VIDISCA-454 (virus discovery cDNA-AFLP combined with Roche 454 high-throughput sequencing) resulted in the discovery of a novel type of rhinovirus C (RV-C). The virus has an RNA genome of at least 7054 nt and carries the characteristics of rhinovirus C species. The gene encoding viral protein 1, which is used for ...[more]
Similar Datasets
Project description:Rhinoviruses (RVs) are the major causes of common colds in humans. They have a nonenveloped, icosahedral capsid surrounding a positive-strand RNA genome. Here we report that the antigen-binding (Fab) fragment of a neutralizing antibody (C5) can trigger genome release from RV-B14 to form emptied particles and neutralize virus infection. Using cryo-electron microscopy, structures of the C5 Fab in complex with the full and emptied particles have been determined at 2.3 Å and 3.0 Å resolution, respectively. Each of the 60 Fab molecules binds primarily to a region on viral protein 3 (VP3). Binding of the C5 Fabs to RV-B14 results in significant conformational changes around holes in the capsid through which the viral RNA might exit. These results are so far the highest resolution view of an antibody-virus complex and elucidate a mechanism whereby antibodies neutralize RVs and related viruses by inducing virus uncoating.
| S-EPMC5544331 | biostudies-literature
Project description:HeLa cells were stably transfected with a cDNA clone encoding the B1 isoform of the mouse FcgammaRII receptor (hereafter referred to as HeLa-FcRII cells). The receptor was expressed at high level at the plasma membrane in about 90% of the cells. These cells bound and internalized mouse monoclonal virus-neutralizing antibodies 8F5 and 3B10 of the subtype immunoglobulin G2a (IgG2a) and IgG1, respectively. Binding of the minor-group human rhinovirus type 2 (HRV2) to its natural receptors, members of the low-density lipoprotein receptor family, is dependent on the presence of Ca(2+) ions. Thus, chelating Ca(2+) ions with EDTA prevented HRV2 binding, entry, and infection. However, upon complex formation of (35)S-labeled HRV2 with 8F5 or 3B10, virus was bound, internalized, and degraded in HeLa-FcRII cells. Furthermore, challenge of these cells with HRV2-8F5 or HRV2-3B10 complexes resulted in de novo synthesis of viral proteins, as shown by indirect immunofluorescence microscopy. These data demonstrate that minor-group receptors can be replaced by surrogate receptors to mediate HRV2 cell entry, delivery into endosomal compartments, and productive uncoating. Consequently, the conformational change and uncoating of HRV2 appears to be solely triggered by the low-pH (pH </= 5.6) environment in these compartments.
| S-EPMC353733 | biostudies-other
Project description:BACKGROUND: 454 sequencing is currently the method of choice for sequencing of antibody repertoires and libraries containing large numbers (106 to 1012) of different molecules with similar frameworks and variable regions which poses significant challenges for identifying sequencing errors. Identification and correction of sequencing errors in such mixtures is especially important for the exploration of complex maturation pathways and identification of putative germline predecessors of highly somatically mutated antibodies. To quantify and correct errors incorporated in 454 antibody sequencing, we sequenced six antibodies at different known concentrations twice over and compared them with the corresponding known sequences as determined by standard Sanger sequencing. RESULTS: We found that 454 antibody sequencing could lead to approximately 20% incorrect reads due to insertions that were mostly found at shorter homopolymer regions of 2-3 nucleotide length, and less so by insertions, deletions and other variants at random sites. Correction of errors might reduce this population of erroneous reads down to 5-10%. However, there are a certain number of errors accounting for 4-8% of the total reads that could not be corrected unless several repeated sequencing is performed, although this may not be possible for large diverse libraries and repertoires including complete sets of antibodies (antibodyomes). CONCLUSIONS: The experimental test procedure carried out for assessing 454 antibody sequencing errors reveals high (up to 20%) incorrect reads; the errors can be reduced down to 5-10% but not less which suggests the use of caution to avoid false discovery of antibody variants and diversity.
| S-EPMC3228814 | biostudies-other
Project description:Human rhinovirus (RV), the major cause of the common cold, triggers the majority of acute airway exacerbations in patients with asthma and chronic obstructive pulmonary disease. Nitric oxide, and the related metabolite S-nitrosoglutathione, are produced in the airway epithelium via nitric oxide synthase (NOS) 2 and have been shown to function in host defense against RV infection. We hypothesized that inhibitors of the S-nitrosoglutathione-metabolizing enzyme, S-nitrosoglutathione reductase (GSNOR), might potentiate the antiviral properties of airway-derived NOS2. Using in vitro models of RV-A serotype 16 (RV-A16) and mNeonGreen-H1N1pr8 infection of human airway epithelial cells, we found that treatment with a previously characterized GSNOR inhibitor (4-[[2-[[(3-cyanophenyl)methyl]thio]-4-oxothieno-[3,2-d]pyrimidin-3(4H)-yl]methyl]-benzoic acid; referred to as C3m) decreased RV-A16 replication and expression of downstream proinflammatory and antiviral mediators (e.g., RANTES [regulated upon activation, normal T cell expressed and secreted], CXCL10, and Mx1), and increased Nrf2 (nuclear factor erythroid 2-related factor 2)-dependent genes (e.g., SQSTM1 and TrxR1). In contrast, C3m had no effect on influenza virus H1N1pr8 replication. Moreover, a structurally dissimilar GSNOR inhibitor (N6022) did not alter RV replication, suggesting that the properties of C3m may be specific to rhinovirus owing to an off-target effect. Consistent with this, C3m antiviral effects were not blocked by either NOS inhibition or GSNOR knockdown but appeared to be mediated by reduced intercellular adhesion molecule 1 transcription and increased shedding of soluble intercellular adhesion molecule 1 protein. Collectively these data show that C3m has novel antirhinoviral properties that may synergize with, but are unrelated to, its GSNOR inhibitor activity.
| S-EPMC6348719 | biostudies-literature
Project description:BACKGROUND:The transmembrane glycoprotein CD133 is believed to be a marker of adult prostate stem cells and cancer stem/initiating cells. Investigating the role of CD133 in the normal biology of the prostate and in cancer is complicated by the lack of a sensitive and accurate antibody for its detection. Here, we describe the characterization of a unique antibody identified using human antibody phage display that can recognize CD133 in both formalin-fixed tissues and cell lines. METHODS:A human single-chain variable fragment (scFv) antibody phage display library possessing a diversity of 8?×?109 was screened against fully glycosylated recombinant CD133. A counter screen was performed against deglycosylated CD133 to select for clones that preferentially recognized a glycosylation-independent epitope. The lead scFv was analyzed by flow cytometry and cloned into a rabbit immunoglobulin scaffold for immunohistochemistry (IHC). RESULTS:The antibody designated HA10 was found to bind a glycosylation-independent epitope on the peptide backbone of CD133 with high affinity. As a reagent for flow cytometry, HA10 detected CD133 more accurately than a commonly used commercially available antibody. IHC analysis with HA10 documented the staining of basal cells and luminal cells in healthy prostate sections. Weak staining of luminal cells was observed in adenocarcinoma sections at a very low frequency. Examination of a LuCaP patient-derived xenograft tissue microarray found that only three of the LuCaP models were positive for CD133. The three CD133pos LuCaP models all originated from non-AR driven metastatic prostate cancer with neuroendocrine differentiation. Subsequent interrogation of liver biopsies from a patient who failed second-generation anti-androgen therapy found high levels of CD133 staining. The original transurethral resection of the prostate from that patient was, however, absent of CD133. CONCLUSIONS:We have developed a novel antibody that was able to detect CD133 by both IHC and flow cytometry. Using HA10 as an IHC reagent, we found that CD133 is a marker for a very rare cell type in both healthy prostate and adenocarcinoma sections. Our preliminary investigation also suggests that there may be an association between CD133 and non-AR driven prostate cancer with neuroendocrine differentiation.
| S-EPMC6378884 | biostudies-literature
Project description:Transcriptomic analyses have revealed an unexpected complexity of the human transcriptome, whose breadth and depth exceeds current RNA sequencing capacity 1-3. Here we combine tiling arrays and RNA sequencing technologies, in an approach we term RNA Capture-Seq, to enable the assembly and characterisation of transcripts whose expression level is below the detection limits of conventional sequencing approaches. By this technique we identify novel exons and splicing patterns to even well-studied genes, such as the p53 and Hox loci, and expose widespread, regulated and remarkably complex noncoding transcription in intergenic regions. We show that unassigned tags observed in conventional RNA sequencing datasets are not noise but can derive from rare transcripts fully assembled by RNA Capture-Seq. We expect RNA Capture-Seq to prove an invaluable technique for future research into gene expression and its relationship to phenotypic variation.
2011-09-12 | GSE29040 | GEO
Project description:Although often ignored, human rhinoviruses (HRVs) are the most frequent causes of respiratory tract infections (RTIs). A group of closely related novel rhinoviruses have recently been discovered. Based on their unique phylogenetic position and distinct genomic features, they are classified as a separate species, HRV-C. After their discovery, HRV-C viruses have been detected in patients worldwide, with a reported prevalence of 1.4-30.9% among tested specimens. This suggests that the species contribute to a significant proportion of RTIs that were unrecognized in the past. HRV-C is also the predominant HRV species, often with a higher detection rate than that of the two previously known species, HRV-A and HRV-B. HRV-C infections appear to peak in fall or winter in most temperate or subtropical countries, but may predominate in the rainy season in the tropics. In children, HRV-C is often associated with upper RTIs, with asthma exacerbation and wheezing episodes being common complications. The virus has also been detected in children with bronchitis, bronchiolitis, pneumonia, otitis media, sinusitis and systemic infections complicated by pericarditis. As for adults, HRV-C has been associated with more severe disease such as pneumonia and exacerbation of chronic obstructive pulmonary disease. However, larger clinical studies with asymptomatic controls are required to better define the significance of HRV-C infection in the adult population. On the basis of VP4 sequence analysis, a potential distinct subgroup within HRV-C has also been identified, although more complete genome sequences are needed to better define the genetic diversity of HRV-C.
| S-EPMC3167658 | biostudies-literature
Project description:Human rhinoviruses (HRV) cause the majority of common colds and acute exacerbations of asthma and chronic obstructive pulmonary disease (COPD). Effective therapies are urgently needed, but no licensed treatments or vaccines currently exist. Of the 100 identified serotypes, ?90% bind domain 1 of human intercellular adhesion molecule-1 (ICAM-1) as their cellular receptor, making this an attractive target for development of therapies; however, ICAM-1 domain 1 is also required for host defence and regulation of cell trafficking, principally via its major ligand LFA-1. Using a mouse anti-human ICAM-1 antibody (14C11) that specifically binds domain 1 of human ICAM-1, we show that 14C11 administered topically or systemically prevented entry of two major groups of rhinoviruses, HRV16 and HRV14, and reduced cellular inflammation, pro-inflammatory cytokine induction and virus load in vivo. 14C11 also reduced cellular inflammation and Th2 cytokine/chemokine production in a model of major group HRV-induced asthma exacerbation. Interestingly, 14C11 did not prevent cell adhesion via human ICAM-1/LFA-1 interactions in vitro, suggesting the epitope targeted by 14C11 was specific for viral entry. Thus a human ICAM-1 domain-1-specific antibody can prevent major group HRV entry and induction of airway inflammation in vivo.
| S-EPMC3731244 | biostudies-literature
Project description:ObjectiveGenome wide association studies (GWAS) for type 2 diabetes (T2D) have identified genetic loci that often localise in non-coding regions of the genome, suggesting gene regulation effects. We combined genetic and transcriptomic analysis from human islets obtained from brain-dead organ donors or surgical patients to detect expression quantitative trait loci (eQTLs) and shed light into the regulatory mechanisms of these genes.MethodsPancreatic islets were isolated either by laser capture microdissection (LCM) from surgical specimens of 103 metabolically phenotyped pancreatectomized patients (PPP) or by collagenase digestion of pancreas from 100 brain-dead organ donors (OD). Genotyping (> 8.7 million single nucleotide polymorphisms) and expression (> 47,000 transcripts and splice variants) analyses were combined to generate cis-eQTLs.ResultsAfter applying genome-wide false discovery rate significance thresholds, we identified 1,173 and 1,021 eQTLs in samples of OD and PPP, respectively. Among the strongest eQTLs shared between OD and PPP were CHURC1 (OD p-value=1.71 × 10-24; PPP p-value = 3.64 × 10-24) and PSPH (OD p-value = 3.92 × 10-26; PPP p-value = 3.64 × 10-24). We identified eQTLs in linkage-disequilibrium with GWAS loci T2D and associated traits, including TTLL6, MLX and KIF9 loci, which do not implicate the nearest gene. We found in the PPP datasets 11 eQTL genes, which were differentially expressed in T2D and two genes (CYP4V2 and TSEN2) associated with HbA1c but none in the OD samples.ConclusionseQTL analysis of LCM islets from PPP led us to identify novel genes which had not been previously linked to islet biology and T2D. The understanding gained from eQTL approaches, especially using surgical samples of living patients, provides a more accurate 3-dimensional representation than those from genetic studies alone.
| S-EPMC6531807 | biostudies-literature
Project description:Transcriptomic analyses have revealed an unexpected complexity of the human transcriptome, whose breadth and depth exceeds current RNA sequencing capacity 1-3. Here we combine tiling arrays and RNA sequencing technologies, in an approach we term RNA Capture-Seq, to enable the assembly and characterisation of transcripts whose expression level is below the detection limits of conventional sequencing approaches. By this technique we identify novel exons and splicing patterns to even well-studied genes, such as the p53 and Hox loci, and expose widespread, regulated and remarkably complex noncoding transcription in intergenic regions. We show that unassigned tags observed in conventional RNA sequencing datasets are not noise but can derive from rare transcripts fully assembled by RNA Capture-Seq. We expect RNA Capture-Seq to prove an invaluable technique for future research into gene expression and its relationship to phenotypic variation. Application of RNA Capture sequencing from human fibroblasts for identifying rare novel transcripts. Hybridization enhancing oligos are designed to cover the full sequencing adaptor and MID sequences during hybridisation. Enhancing Oligo A 5 CCATCTCATCCCTGCGTGTCTCCGACTCAG/3ddc/ Enhancing Oligo B 5' CCTATCCCCTGTGTGCCTTGGCAGTCTCAG/3ddc/
2011-09-12 | E-GEOD-29040 | biostudies-arrayexpress