Dataset Information

Detection of High Cerebrospinal Fluid Levels of (1?3)-?-d-Glucan in Cryptococcal Meningitis.

ABSTRACT: BACKGROUND:(1?3)-?-d-Glucan (BDG) is a helpful diagnostic marker for many invasive fungal infections. However, BDG is not thought to be useful in diagnosing cryptococcosis. We evaluated the utility of BDG as an adjunct diagnostic tool for patients infected with human immunodeficiency virus (HIV) and presenting with suspected cryptococcal meningitis. METHODS:The Fungitell assay was used to measure BDG concentrations in cerebrospinal fluid (CSF) (n = 177) and serum (n = 109) of HIV-infected Ugandans and South Africans with suspected meningitis. Correlations between BDG concentrations and quantitative CSF cryptococcal cultures, CSF cryptococcal antigen (CRAG) titers, and 18 different CSF cytokine concentrations were assessed using non-parametric tests. Mixed models evaluated longitudinal changes in CSF BDG concentrations. Survival analyses were used to evaluate BDG's relationship with mortality. RESULTS:The Fungitell BDG assay provided 89% sensitivity and 85% specificity in CSF for cryptococcal meningitis. Serum sensitivity was suboptimal (79%). Cerebrospinal fluid BDG concentrations at diagnosis were median (interquartile range) 343 (200-597) pg/mL in cryptococcal patients and 37 (23-46) pg/mL in patients without cryptococcosis. Sensitivity in CSF improved to 98% (53 of 54) when initial fungal burdens were ?10 000 colony-forming units/mL. (1?3)-?-d-Glucan normalized rapidly after initiating antifungal therapy. Baseline BDG concentrations correlated with CSF fungal burden (rho = 0.820; P < .001), CSF CRAG lateral flow assay titers (rho = 0.780, P < .001), and monocyte chemotactic protein-1 levels in CSF (P = .047). In patients with cryptococcal meningitis, BDG ?500 pg/mL at diagnosis was associated with increased 10-week mortality. CONCLUSIONS:(1?3)-?-d-Glucan is detectable in the CSF of HIV-infected patients with Cryptococcus, and it may provide useful prognostic information. Sensitivity is less than CRAG; however, BDG normalizes rapidly, unlike CRAG, making BDG potentially useful in diagnosing recurrent episodes.

SUBMITTER: Rhein J

PROVIDER: S-EPMC4324234 | biostudies-literature | 2014 Dec

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Detection of High Cerebrospinal Fluid Levels of (1→3)-β-d-Glucan in Cryptococcal Meningitis.

Rhein Joshua J Bahr Nathan C NC Morawski Bozena M BM Schutz Charlotte C Zhang Yonglong Y Finkelman Malcolm M Meya David B DB Meintjes Graeme G Boulware David R DR

Open forum infectious diseases 20141126 3

<h4>Background</h4>(1→3)-β-d-Glucan (BDG) is a helpful diagnostic marker for many invasive fungal infections. However, BDG is not thought to be useful in diagnosing cryptococcosis. We evaluated the utility of BDG as an adjunct diagnostic tool for patients infected with human immunodeficiency virus (HIV) and presenting with suspected cryptococcal meningitis.<h4>Methods</h4>The Fungitell assay was used to measure BDG concentrations in cerebrospinal fluid (CSF) (n = 177) and serum (n = 109) of HIV- ...[more]

PMID: 25734173

Similar Datasets

Project description:BackgroundQuantitative culture is the most common method to determine the fungal burden and sterility of cerebrospinal fluid (CSF) among persons with cryptococcal meningitis. A major drawback of cultures is a long turnaround-time. Recent evidence demonstrates that live and dead Cryptococcus yeasts can be distinguished using trypan blue staining. We hypothesized that trypan blue staining combined with haemocytometer counting may provide a rapid estimation of quantitative culture count and detection of CSF sterility. To test this, we evaluated 194 CSF specimens from 96 HIV-infected participants with cryptococcal meningitis in Kampala, Uganda. Cryptococcal meningitis was diagnosed by CSF cryptococcal antigen (CRAG). We stained CSF with trypan blue and quantified yeasts using a haemocytometer. We compared the haemocytometer readings versus quantitative Cryptococcus CSF cultures.ResultsHaemocytometer counting with trypan blue staining had a sensitivity of 98% (64/65), while CSF cultures had a sensitivity of 95% (62/65) with reference to CSF CRAG for diagnostic CSF specimens. For samples that were positive in both tests, the haemocytometer had higher readings compared to culture. For diagnostic specimens, the median of log10 transformed counts were 5.59 (n = 64, IQR = 5.09 to 6.05) for haemocytometer and 4.98 (n = 62, IQR = 3.75 to 5.79) for culture; while the overall median counts were 5.35 (n = 189, IQR = 4.78-5.84) for haemocytometer and 3.99 (n = 151, IQR = 2.59-5.14) for cultures. The percentage agreement with culture sterility was 2.4% (1/42). Counts among non-sterile follow-up specimens had a median of 5.38 (n = 86, IQR = 4.74 to 6.03) for haemocytometer and 2.89 (n = 89, IQR = 2.11 to 4.38) for culture. At diagnosis, CSF quantitative cultures correlated with haemocytometer counts (R2 = 0.59, P < 0.001). At 7-14 days, quantitative cultures did not correlate with haemocytometer counts (R2 = 0.43, P = 0.4).ConclusionDespite a positive correlation, the haemocytometer counts with trypan blue staining did not predict the outcome of quantitative cultures in patients receiving antifungal therapy.

Project description:BackgroundCryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons.MethodsThe CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software.ResultsThe 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed.ConclusionsThe metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.

Dataset Information

Detection of High Cerebrospinal Fluid Levels of (1?3)-?-d-Glucan in Cryptococcal Meningitis.

Publications

Detection of High Cerebrospinal Fluid Levels of (1→3)-β-d-Glucan in Cryptococcal Meningitis.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets