Dataset Information

Cerebrospinal Fluid Lactate as a Prognostic Marker of Disease Severity and Mortality in Cryptococcal Meningitis.

ABSTRACT:

Background

Cerebrospinal fluid (CSF) lactate levels can be used to differentiate between bacterial and viral meningitis. We measured CSF lactate in individuals with cryptococcal meningitis to determine its clinical significance.

Methods

We measured point-of-care CSF lactate at the bedside of 319 Ugandan adults living with human immunodeficiency virus at diagnosis of cryptococcal meningitis. We summarized demographic variables and clinical characteristics by CSF lactate tertiles. We evaluated the association of CSF lactate with clinical characteristics and survival.

Results

Individuals with high CSF lactate >5 mmol/L at cryptococcal diagnosis more likely presented with altered mental status (P < .0001), seizures (P = .0005), elevated intracranial opening pressure (P = .03), higher CSF white cells (P = .007), and lower CSF glucose (P = .0003) compared with those with mid-range (3.1 to 5 mmol/L) or low (≤3 mmol/L) CSF lactate levels. Two-week mortality was higher among individuals with high baseline CSF lactate >5 mmol/L (35%; 38 of 109) compared with individuals with mid-range (22%; 25 of 112) or low CSF lactate (9%; 9 of 97; P =<.0001). After multivariate adjustment, CSF lactate >5 mmol/L remained independently associated with excess mortality (adjusted hazard ratio = 3.41; 95% confidence interval, 1.55-7.51; P = .002). We found no correlation between baseline CSF lactate levels and blood capillary lactate levels.

Conclusions

Baseline point-of-care CSF lactate levels are a prognostic marker of disease severity and mortality in cryptococcal meningitis. Individuals with an elevated baseline CSF lactate level are more likely to present with altered mental status, seizures, and elevated CSF opening pressure and are at a greater risk of death. Future studies are needed to determine targeted therapeutic management strategies in persons with high CSF lactate.

SUBMITTER: Abassi M

PROVIDER: S-EPMC8563209 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Similar Datasets

Project description:Understanding the host immune response during cryptococcal meningitis (CM) is of critical importance for the development of immunomodulatory therapies. We profiled the cerebrospinal fluid (CSF) immune-response in ninety patients with HIV-associated CM, and examined associations between immune phenotype and clinical outcome. CSF cytokine, chemokine, and macrophage activation marker concentrations were assayed at disease presentation, and associations between these parameters and microbiological and clinical outcomes were examined using principal component analysis (PCA). PCA demonstrated a co-correlated CSF cytokine and chemokine response consisting primarily of Th1, Th2, and Th17-type cytokines. The presence of this CSF cytokine response was associated with evidence of increased macrophage activation, more rapid clearance of Cryptococci from CSF, and survival at 2 weeks. The key components of this protective immune-response were interleukin (IL)-6 and interferon-γ, IL-4, IL-10 and IL-17 levels also made a modest positive contribution to the PC1 score. A second component of co-correlated chemokines was identified by PCA, consisting primarily of monocyte chemotactic protein-1 (MCP-1) and macrophage inflammatory protein-1α (MIP-1α). High CSF chemokine concentrations were associated with low peripheral CD4 cell counts and CSF lymphocyte counts and were predictive of immune reconstitution inflammatory syndrome (IRIS). In conclusion CSF cytokine and chemokine profiles predict risk of early mortality and IRIS in HIV-associated CM. We speculate that the presence of even minimal Cryptococcus-specific Th1-type CD4+ T-cell responses lead to increased recruitment of circulating lymphocytes and monocytes into the central nervous system (CNS), more effective activation of CNS macrophages and microglial cells, and faster organism clearance; while high CNS chemokine levels may predispose to over recruitment or inappropriate recruitment of immune cells to the CNS and IRIS following peripheral immune reconstitution with ART. These results provide a rational basis for future studies of immune modulation in CM, and demonstrate the potential of baseline immune profiling to identify CM patients most at risk of mortality and subsequent IRIS.

Project description:Background(1→3)-β-d-Glucan (BDG) is a helpful diagnostic marker for many invasive fungal infections. However, BDG is not thought to be useful in diagnosing cryptococcosis. We evaluated the utility of BDG as an adjunct diagnostic tool for patients infected with human immunodeficiency virus (HIV) and presenting with suspected cryptococcal meningitis.MethodsThe Fungitell assay was used to measure BDG concentrations in cerebrospinal fluid (CSF) (n = 177) and serum (n = 109) of HIV-infected Ugandans and South Africans with suspected meningitis. Correlations between BDG concentrations and quantitative CSF cryptococcal cultures, CSF cryptococcal antigen (CRAG) titers, and 18 different CSF cytokine concentrations were assessed using non-parametric tests. Mixed models evaluated longitudinal changes in CSF BDG concentrations. Survival analyses were used to evaluate BDG's relationship with mortality.ResultsThe Fungitell BDG assay provided 89% sensitivity and 85% specificity in CSF for cryptococcal meningitis. Serum sensitivity was suboptimal (79%). Cerebrospinal fluid BDG concentrations at diagnosis were median (interquartile range) 343 (200-597) pg/mL in cryptococcal patients and 37 (23-46) pg/mL in patients without cryptococcosis. Sensitivity in CSF improved to 98% (53 of 54) when initial fungal burdens were ≥10 000 colony-forming units/mL. (1→3)-β-d-Glucan normalized rapidly after initiating antifungal therapy. Baseline BDG concentrations correlated with CSF fungal burden (rho = 0.820; P < .001), CSF CRAG lateral flow assay titers (rho = 0.780, P < .001), and monocyte chemotactic protein-1 levels in CSF (P = .047). In patients with cryptococcal meningitis, BDG ≥500 pg/mL at diagnosis was associated with increased 10-week mortality.Conclusions(1→3)-β-d-Glucan is detectable in the CSF of HIV-infected patients with Cryptococcus, and it may provide useful prognostic information. Sensitivity is less than CRAG; however, BDG normalizes rapidly, unlike CRAG, making BDG potentially useful in diagnosing recurrent episodes.

Project description:BackgroundCryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons.MethodsThe CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software.ResultsThe 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed.ConclusionsThe metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.