Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

An analytical framework for optimizing variant discovery from personal genomes.

ABSTRACT: The standardization and performance testing of analysis tools is a prerequisite to widespread adoption of genome-wide sequencing, particularly in the clinic. However, performance testing is currently complicated by the paucity of standards and comparison metrics, as well as by the heterogeneity in sequencing platforms, applications and protocols. Here we present the genome comparison and analytic testing (GCAT) platform to facilitate development of performance metrics and comparisons of analysis tools across these metrics. Performance is reported through interactive visualizations of benchmark and performance testing data, with support for data slicing and filtering. The platform is freely accessible at http://www.bioplanet.com/gcat.

SUBMITTER: Highnam G

PROVIDER: S-EPMC4351570 | biostudies-literature | 2015

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

An analytical framework for optimizing variant discovery from personal genomes.

Highnam Gareth G Wang Jason J JJ Kusler Dean D Zook Justin J Vijayan Vinaya V Leibovich Nir N Mittelman David D

Nature communications 20150225

The standardization and performance testing of analysis tools is a prerequisite to widespread adoption of genome-wide sequencing, particularly in the clinic. However, performance testing is currently complicated by the paucity of standards and comparison metrics, as well as by the heterogeneity in sequencing platforms, applications and protocols. Here we present the genome comparison and analytic testing (GCAT) platform to facilitate development of performance metrics and comparisons of analysis ...[more]

PMID: 25711446

Similar Datasets

LUMPY: a probabilistic framework for structural variant discovery.

Project description:Comprehensive discovery of structural variation (SV) from whole genome sequencing data requires multiple detection signals including read-pair, split-read, read-depth and prior knowledge. Owing to technical challenges, extant SV discovery algorithms either use one signal in isolation, or at best use two sequentially. We present LUMPY, a novel SV discovery framework that naturally integrates multiple SV signals jointly across multiple samples. We show that LUMPY yields improved sensitivity, especially when SV signal is reduced owing to either low coverage data or low intra-sample variant allele frequency. We also report a set of 4,564 validated breakpoints from the NA12878 human genome. https://github.com/arq5x/lumpy-sv.

| S-EPMC4197822 | biostudies-literature

Comparative analysis of de novo assemblers for variation discovery in personal genomes.

Project description:Current variant discovery approaches often rely on an initial read mapping to the reference sequence. Their effectiveness is limited by the presence of gaps, potential misassemblies, regions of duplicates with a high-sequence similarity and regions of high-sequence divergence in the reference. Also, mapping-based approaches are less sensitive to large INDELs and complex variations and provide little phase information in personal genomes. A few de novo assemblers have been developed to identify variants through direct variant calling from the assembly graph, micro-assembly and whole-genome assembly, but mainly for whole-genome sequencing (WGS) data. We developed SGVar, a de novo assembly workflow for haplotype-based variant discovery from whole-exome sequencing (WES) data. Using simulated human exome data, we compared SGVar with five variation-aware de novo assemblers and with BWA-MEM together with three haplotype- or local de novo assembly-based callers. SGVar outperforms the other assemblers in sensitivity and tolerance of sequencing errors. We recapitulated the findings on whole-genome and exome data from a Utah residents with Northern and Western European ancestry (CEU) trio, showing that SGVar had high sensitivity both in the highly divergent human leukocyte antigen (HLA) region and in non-HLA regions of chromosome 6. In particular, SGVar is robust to sequencing error, k-mer selection, divergence level and coverage depth. Unlike mapping-based approaches, SGVar is capable of resolving long-range phase and identifying large INDELs from WES, more prominently from WGS. We conclude that SGVar represents an ideal platform for WES-based variant discovery in highly divergent regions and across the whole genome.

| S-EPMC6169673 | biostudies-literature

On Variant Discovery in Genomes of Fungal Plant Pathogens.

Project description:Comparative genome analyses of eukaryotic pathogens including fungi and oomycetes have revealed extensive variability in genome composition and structure. The genomes of individuals from the same population can exhibit different numbers of chromosomes and different organization of chromosomal segments, defining so-called accessory compartments that have been shown to be crucial to pathogenicity in plant-infecting fungi. This high level of structural variation confers a methodological challenge for population genomic analyses. Variant discovery from population sequencing data is typically achieved using established pipelines based on the mapping of short reads to a reference genome. These pipelines have been developed, and extensively used, for eukaryote genomes of both plants and animals, to retrieve single nucleotide polymorphisms and short insertions and deletions. However, they do not permit the inference of large-scale genomic structural variation, as this task typically requires the alignment of complete genome sequences. Here, we compare traditional variant discovery approaches to a pipeline based on de novo genome assembly of short read data followed by whole genome alignment, using simulated data sets with properties mimicking that of fungal pathogen genomes. We show that the latter approach exhibits levels of performance comparable to that of read-mapping based methodologies, when used on sequence data with sufficient coverage. We argue that this approach further allows additional types of genomic diversity to be explored, in particular as long-read third-generation sequencing technologies are becoming increasingly available to generate population genomic data.

| S-EPMC7176817 | biostudies-literature

Mapping personal functional data to personal genomes.

Project description:The sequencing of personal genomes enabled analysis of variation in transcription factor (TF) binding, chromatin structure and gene expression and indicated how they contribute to phenotypic variation. It is hypothesized that using the reference genome for mapping ChIP-seq or RNA-seq reads may introduce errors, especially at polymorphic genomic regions.We developed a Personal Genome Editor (perEditor) that changes the reference human genome (NCBI36/hg18) into an individual genome, taking into account single nucleotide polymorphisms (SNPs), insertions and deletions, copy number variation, and chromosomal rearrangements. perEditor outputs two alleles (maternal, paternal) of the individual genome that is ready for mapping ChIP-seq and RNA-seq reads, and enabling the analyses of allele specific binding, chromatin structure and gene expression.perEditor is available at http://biocomp.bioen.uiuc.edu/perEditor.szhong@illinois.edu.

| S-EPMC3232370 | biostudies-literature

VAT: a computational framework to functionally annotate variants in personal genomes within a cloud-computing environment.

Project description:UnlabelledThe functional annotation of variants obtained through sequencing projects is generally assumed to be a simple intersection of genomic coordinates with genomic features. However, complexities arise for several reasons, including the differential effects of a variant on alternatively spliced transcripts, as well as the difficulty in assessing the impact of small insertions/deletions and large structural variants. Taking these factors into consideration, we developed the Variant Annotation Tool (VAT) to functionally annotate variants from multiple personal genomes at the transcript level as well as obtain summary statistics across genes and individuals. VAT also allows visualization of the effects of different variants, integrates allele frequencies and genotype data from the underlying individuals and facilitates comparative analysis between different groups of individuals. VAT can either be run through a command-line interface or as a web application. Finally, in order to enable on-demand access and to minimize unnecessary transfers of large data files, VAT can be run as a virtual machine in a cloud-computing environment.Availability and implementationVAT is implemented in C and PHP. The VAT web service, Amazon Machine Image, source code and detailed documentation are available at vat.gersteinlab.org.

| S-EPMC3426844 | biostudies-literature

bigSCale: An Analytical Framework for Big-Scale Single Cell Data

Project description:Single-cell RNA sequencing significantly deepened our insights into complex tissues and latest techniques are capable to analyze ten-thousands of cells simultaneously. With bigSCale, we provide an analytical framework being scalable to analyze millions of cells, addressing challenges of future large data sets. Unlike other methods, bigSCale does not constrain data to fit an a priori-defined distribution and instead uses an accurate numerical model of noise. We evaluate the performance of bigSCale using a biological model of aberrant gene expression and simulated data sets, which underlined its speed and accuracy. We further apply bigSCale to analyze 1.3 million cells from the mouse developing forebrain. The directed down-sampling strategy identified rare populations, such as Reelin positive Cajal-Retzius neurons, for which we determined a previously not recognized heterogeneity associated to distinct differentiation stages, spatial organization and cellular function. Together, bigSCale presents a perfect solution to address future challenges of large single-cell data sets.

2018-04-15 | GSE102934 | GEO

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing

Project description:This SuperSeries is composed of the following subset Series: GSE14694: Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility) GSE14695: Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards) Refer to individual Series

2009-06-02 | E-GEOD-14696 | biostudies-arrayexpress

A universal framework for regulatory element discovery across all genomes and data types.

Project description:Deciphering the noncoding regulatory genome has proved a formidable challenge. Despite the wealth of available gene expression data, there currently exists no broadly applicable method for characterizing the regulatory elements that shape the rich underlying dynamics. We present a general framework for detecting such regulatory DNA and RNA motifs that relies on directly assessing the mutual information between sequence and gene expression measurements. Our approach makes minimal assumptions about the background sequence model and the mechanisms by which elements affect gene expression. This provides a versatile motif discovery framework, across all data types and genomes, with exceptional sensitivity and near-zero false-positive rates. Applications from yeast to human uncover putative and established transcription-factor binding and miRNA target sites, revealing rich diversity in their spatial configurations, pervasive co-occurrences of DNA and RNA motifs, context-dependent selection for motif avoidance, and the strong impact of posttranscriptional processes on eukaryotic transcriptomes.

| S-EPMC2900317 | biostudies-literature

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (reproducibility)

Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to assess the reproducibility of small RNA datasets produced using Illumina sequencing-by-synthesis technology (SBS). We analyzed the reproducibility of small RNA SBS datasets by comparing libraries generated for biological replicates (rep1 and rep2) and technical replicates (rep2 and rep3).

2009-06-02 | E-GEOD-14694 | biostudies-arrayexpress

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)

Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards. We assessed the use of synthetic oligoribonucleotide standards as spike-in controls. These standards can be used to set an objective standard against which to compare samples. Standards were added to the total RNA (100 ug) in the following amounts: Std2 (TATATGCAAGTCCGGCCATAC) 0.01 pmol, Std3 (TAGCTAACGCATATCCGCATC) 0.1 pmol, Std6 (TGAAGCTGACATCGGTCATCC) 1.0 pmol.

2009-06-02 | E-GEOD-14695 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data