Dataset Information

Targeted and genome-wide sequencing reveal single nucleotide variations impacting specificity of Cas9 in human stem cells.

ABSTRACT: CRISPR/Cas9 has demonstrated a high-efficiency in site-specific gene targeting. However, potential off-target effects of the Cas9 nuclease represent a major safety concern for any therapeutic application. Here, we knock out the Tafazzin gene by CRISPR/Cas9 in human-induced pluripotent stem cells with 54% efficiency. We combine whole-genome sequencing and deep-targeted sequencing to characterise the off-target effects of Cas9 editing. Whole-genome sequencing of Cas9-modified hiPSC clones detects neither gross genomic alterations nor elevated mutation rates. Deep sequencing of in silico predicted off-target sites in a population of Cas9-treated cells further confirms high specificity of Cas9. However, we identify a single high-efficiency off-target site that is generated by a common germline single-nucleotide variant (SNV) in our experiment. Based on in silico analysis, we estimate a likelihood of SNVs creating off-target sites in a human genome to be ~1.5-8.5%, depending on the genome and site-selection method, but also note that mutations might be generated at these sites only at low rates and may not have functional consequences. Our study demonstrates the feasibility of highly specific clonal ex vivo gene editing using CRISPR/Cas9 and highlights the value of whole-genome sequencing before personalised CRISPR design.

SUBMITTER: Yang L

PROVIDER: S-EPMC4352754 | biostudies-literature | 2014 Nov

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Targeted and genome-wide sequencing reveal single nucleotide variations impacting specificity of Cas9 in human stem cells.

Yang Luhan L Grishin Dennis D Wang Gang G Aach John J Zhang Cheng-Zhong CZ Chari Raj R Homsy Jason J Cai Xuyu X Zhao Yue Y Fan Jian-Bing JB Seidman Christine C Seidman Jonathan J Pu William W Church George G

Nature communications 20141126

CRISPR/Cas9 has demonstrated a high-efficiency in site-specific gene targeting. However, potential off-target effects of the Cas9 nuclease represent a major safety concern for any therapeutic application. Here, we knock out the Tafazzin gene by CRISPR/Cas9 in human-induced pluripotent stem cells with 54% efficiency. We combine whole-genome sequencing and deep-targeted sequencing to characterise the off-target effects of Cas9 editing. Whole-genome sequencing of Cas9-modified hiPSC clones detects ...[more]

PMID: 25425480

Similar Datasets

Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome

Dataset Information

Targeted and genome-wide sequencing reveal single nucleotide variations impacting specificity of Cas9 in human stem cells.

Publications

Targeted and genome-wide sequencing reveal single nucleotide variations impacting specificity of Cas9 in human stem cells.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets