Targeted and genome-wide sequencing reveal single nucleotide variations impacting specificity of Cas9 in human stem cells.
Ontology highlight
ABSTRACT:
SUBMITTER: Yang L
PROVIDER: S-EPMC4352754 | biostudies-literature | 2014 Nov
REPOSITORIES: biostudies-literature
Publications
Targeted and genome-wide sequencing reveal single nucleotide variations impacting specificity of Cas9 in human stem cells.
Yang Luhan L Grishin Dennis D Wang Gang G Aach John J Zhang Cheng-Zhong CZ Chari Raj R Homsy Jason J Cai Xuyu X Zhao Yue Y Fan Jian-Bing JB Seidman Christine C Seidman Jonathan J Pu William W Church George G
Nature communications 20141126
CRISPR/Cas9 has demonstrated a high-efficiency in site-specific gene targeting. However, potential off-target effects of the Cas9 nuclease represent a major safety concern for any therapeutic application. Here, we knock out the Tafazzin gene by CRISPR/Cas9 in human-induced pluripotent stem cells with 54% efficiency. We combine whole-genome sequencing and deep-targeted sequencing to characterise the off-target effects of Cas9 editing. Whole-genome sequencing of Cas9-modified hiPSC clones detects ...[more]
Similar Datasets
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of target site recognition. Cleavage specificity is typically evaluated by low throughput assays (T7 endonuclease I assay, target amplification followed by high-throughput sequencing), which are limited to a subset of potential off-target sites. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites for two guide RNAs. RNA-guided Cas9 binding was highly specific to the target site while off-target binding occurred at much lower intensities. Cas9-bound regions were highly enriched in NGG sites, a sequence required for target site recognition by Streptococcus pyogenes Cas9. To determine the relationship between Cas9 binding and endonuclease activity, we applied targeted sequence capture, which allowed us to survey 1200 genomic loci simultaneously including potential off-target sites identified by ChIP-seq and by computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results confirm the high-specificity of CRISPR endonucleases and demonstrate that sequence capture can be used as a high-throughput genome-wide approach to identify off-target activity.
| S-EPMC4381059 | biostudies-literature
Project description:The CRISPR system has become heavily utilized in biomedical research as a tool for genomic editing as well as for site-specific chromosomal localization of specific proteins. For example, we developed a CRISPR-based methodology for enriching a specific genomic locus of interest for proteomic analysis in Saccharomyces cerevisiae, which utilized a guide RNA-targeted, catalytically dead Cas9 (dCas9) as an affinity reagent. To more comprehensively evaluate the genomic specificity of using dCas9 as a site-specific tool for chromosomal studies, we performed dCas9-mediated locus enrichment followed by next-generation sequencing on a genome-wide scale. As a test locus, we used the ARS305 origin of replication on chromosome III in S. cerevisiae. We found that enrichment of this site is highly specific, with virtually no off-target enrichment of unique genomic sequences. The high specificity of genomic localization and enrichment suggests that dCas9-mediated technologies have promising potential for site-specific chromosomal studies in organisms with relatively small genomes such as yeasts.
| S-EPMC7395602 | biostudies-literature
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:Despite recent improvements in sequencing methods, there remains a need for assays that provide high sequencing depth and comprehensive variant detection. Current methods1-4 are limited by the loss of native modifications, short read length, high input requirements, low yield or long protocols. In the present study, we describe nanopore Cas9-targeted sequencing (nCATS), an enrichment strategy that uses targeted cleavage of chromosomal DNA with Cas9 to ligate adapters for nanopore sequencing. We show that nCATS can simultaneously assess haplotype-resolved single-nucleotide variants, structural variations and CpG methylation. We apply nCATS to four cell lines, to a cell-line-derived xenograft, and to normal and paired tumor/normal primary human breast tissue. Median sequencing coverage was 675× using a MinION flow cell and 34× using the smaller Flongle flow cell. The nCATS sequencing requires only ~3??g of genomic DNA and can target a large number of loci in a single reaction. The method will facilitate the use of long-read sequencing in research and in the clinic.
| S-EPMC7145730 | biostudies-literature
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage.
2015-03-04 | GSE61099 | GEO
Project description:Mobile element insertions (MEIs) are repetitive genomic sequences that contribute to genetic variation and can lead to genetic disorders. Targeted and whole-genome approaches using short-read sequencing have been developed to identify reference and non-reference MEIs; however, the read length hampers detection of these elements in complex genomic regions. Here, we pair Cas9-targeted nanopore sequencing with computational methodologies to capture active MEIs in human genomes. We demonstrate parallel enrichment for distinct classes of MEIs, averaging 44% of reads on-targeted signals and exhibiting a 13.4-54x enrichment over whole-genome approaches. We show an individual flow cell can recover most MEIs (97% L1Hs, 93% AluYb, 51% AluYa, 99% SVA_F, and 65% SVA_E). We identify seventeen non-reference MEIs in GM12878 overlooked by modern, long-read analysis pipelines, primarily in repetitive genomic regions. This work introduces the utility of nanopore sequencing for MEI enrichment and lays the foundation for rapid discovery of elusive, repetitive genetic elements.
| S-EPMC8196195 | biostudies-literature
Project description:To identify therapeutic targets for glioblastoma (GBM), we performed genome-wide CRISPR-Cas9 knockout (KO) screens in patient-derived GBM stem-like cells (GSCs) and human neural stem/progenitors (NSCs), non-neoplastic stem cell controls, for genes required for their in vitro growth. Surprisingly, the vast majority GSC-lethal hits were found outside of molecular networks commonly altered in GBM and GSCs (e.g., oncogenic drivers). In vitro and in vivo validation of GSC-specific targets revealed several strong hits, including the wee1-like kinase, PKMYT1/Myt1. Mechanistic studies demonstrated that PKMYT1 acts redundantly with WEE1 to inhibit cyclin B-CDK1 activity via CDK1-Y15 phosphorylation and to promote timely completion of mitosis in NSCs. However, in GSCs, this redundancy is lost, most likely as a result of oncogenic signaling, causing GBM-specific lethality.
| S-EPMC4691575 | biostudies-literature
Project description:RNA-guided CRISPR-Cas9 proteins have been widely used for genome editing, but their off-target activities limit broad application. The minimal Cas9 ortholog from Staphylococcus aureus (SaCas9) is commonly used for in vivo genome editing; however, no variant conferring high genome-wide specificity is available. Here, we report rationally engineered SaCas9 variants with highly specific genome-wide activity in human cells without compromising on-target efficiency. One engineered variant, referred to as SaCas9-HF, dramatically improved genome-wide targeting accuracy based on the genome-wide unbiased identification of double-stranded breaks enabled by sequencing (GUIDE-seq) method and targeted deep sequencing analyses. Among 15 tested human endogenous sites with the canonical NNGRRT protospacer adjacent motif (PAM), SaCas9-HF rendered no detectable off-target activities at 9 sites, minimal off-target activities at 6 sites, and comparable on-target efficiencies to those of wild-type SaCas9. Furthermore, among 4 known promiscuous targeting sites, SaCas9-HF profoundly reduced off-target activities compared with wild type. When delivered by an adeno-associated virus vector, SaCas9-HF also showed reduced off-target effects when targeting VEGFA in a human retinal pigmented epithelium cell line compared with wild type. Then, we further altered a previously described variant named KKH-SaCas9 that has a wider PAM recognition range. Similarly, the resulting KKH-HF remarkably reduced off-target activities and increased on- to off-target editing ratios. Our finding provides an alternative to wild-type SaCas9 for genome editing applications requiring exceptional genome-wide precision.
| S-EPMC6800346 | biostudies-literature
Project description:Utilizing the full power of next-generation sequencing often requires the ability to perform large-scale multiplex enrichment of many specific genomic loci in multiple samples. Several technologies have been recently developed but await substantial improvements. We report the 10,000-fold improvement of a previously developed padlock-based approach, and apply the assay to identifying genetic variations in hypermutable CpG regions across human chromosome 21. From approximately 3 million reads derived from a single Illumina Genome Analyzer lane, approximately 94% (approximately 50,500) target sites can be observed with at least one read. The uniformity of coverage was also greatly improved; up to 93% and 57% of all targets fell within a 100- and 10-fold coverage range, respectively. Alleles at >400,000 target base positions were determined across six subjects and examined for single nucleotide polymorphisms (SNPs), and the concordance with independently obtained genotypes was 98.4%-100%. We detected >500 SNPs not currently in dbSNP, 362 of which were in targeted CpG locations. Transitions in CpG sites were at least 13.7 times more abundant than non-CpG transitions. Fractions of polymorphic CpG sites are lower in CpG-rich regions and show higher correlation with human-chimpanzee divergence within CpG versus non-CpG sites. This is consistent with the hypothesis that methylation rate heterogeneity along chromosomes contributes to mutation rate variation in humans. Our success suggests that targeted CpG resequencing is an efficient way to identify common and rare genetic variations. In addition, the significantly improved padlock capture technology can be readily applied to other projects that require multiplex sample preparation.
| S-EPMC2752131 | biostudies-literature
Project description:To study target sequence specificity, selectivity, and reaction kinetics of Streptococcus pyogenes Cas9 activity, we challenged libraries of random variant targets with purified Cas9::guide RNA complexes in vitro. Cleavage kinetics were nonlinear, with a burst of initial activity followed by slower sustained cleavage. Consistent with other recent analyses of Cas9 sequence specificity, we observe considerable (albeit incomplete) impairment of cleavage for targets mutated in the PAM sequence or in "seed" sequences matching the proximal 8 bp of the guide. A second target region requiring close homology was located at the other end of the guide::target duplex (positions 13-18 relative to the PAM). Strikingly, a subset of variants which broke homology in the intervening region consistently increased the capacity of Cas9 to cleave in extended reactions. Sequences flanking the guide+PAM region had measurable (albeit modest) effects on cleavage. Taken together, these studies provide both a basis for predicting effective cleavage targets and a basis for potential optimization of guide RNAs to yield efficiency beyond that of the simple perfect-match guides. 118 samples anaylzed. Controls have con in sample name. To quantitatively measure cleavage efficiency of a single gRNA, we created a population of random variant target sequences to two gRNA targets. The targets used were "unc-22A", [a sequence from the well-characterized unc-22 gene of Caenorhabditis elegans], and "protospacer 4" (ps4), a previously characterized sequence from a natural spacer from S. pyogenes MGAS10750 . Using custom mixtures of oligonucleotide precursors for each base during chemical synthesis, a set of polymorphic target libraries ('Random Variant Libraries') were designed to have a baseline variation rate at each position. On each side of the gRNA homology and PAM regions, 6 bps of random sequence were added. The first base of intended gRNA homology is designated base 1 . The entire 35 bp random variant library mixture was cloned into a standard plasmid vector (pHRL-TK). Several thousand colonies from plates were washed in pools and prepared by standard plasmid preparation methods. The complexity of the libraries were estimated based on Illumina sequencing of the uncut libraries and filtering for minimum representation expected from the pooling. Approximately 1500-3000 unique species were obtained in the unc-22A libraries and 5000 unique sequences in the ps4 library (see Materials and Methods). To assay cleavage, purified Cas9 was first incubated with gRNA, followed by incubation with the variant library for various time points and under various conditions. DNA template is among the conditions varied in the experiments. After protein removal, flanking sequences outside of the target region are used for PCR amplification and plasmid cleavage was measured through loss of PCR products that span the region of interest. A set of perfectly matched targets and highly mutated versions present in the random variant library served as internal positive and negative controls respectively. A log retention score for each sequence in each experiment was calculated by quantifying the representation of each sequence before and after addition of the Cas9 protein. Two approaches were used for normalization: first we used a population of ps4 targets "spiked" into the library as an uncleaved control, second, we used a population of unc-22A targets with large numbers of variations from the perfect target (between 4 and 7), and hence likely limited if any cleavage. Equivalent results are obtained with these two normalization approaches (see Computational Methods for details). Retention scores are expressed as the log2 of the normalized ratio, so that a more negative retention score indicates efficient cleavage of substrate while a less negative score indicates less cleavage. Templates which are uncleaved will yield a retention score at or near zero. Comparisons between multiple experiments indicate strong correlation between independent retention measurements. GSM1410678-GSM1410761; AF_SOL*.dat' files contain the calculated final retentions for each experiment. Each experiment labeled: M-bM-^@M-^\AF_SOL_###_t###M-bM-^@M-^]. M-bM-^@M-^\AF_SOL_###M-bM-^@M-^] corresponds to the experiment run ID and M-bM-^@M-^\t###M-bM-^@M-^] corresponds to the incubation time of the experiment. For example AF_SOL_513_t360, corresponds to experiment 513 on the protospacer 4 guide and DNA target and the incubation time was 360 mins. The experimental conditions and ID can be found in the associated publication. GSM1544297-GSM1544332; unc*.dat file is a tab-delimited file of all considered sequences in each experiment. The names of the files and the AF_SOL_# run number can be found in the associated publication (Supplementary Materials) with the details of the conditions. Each filename starts with the type of gRNA used (either unc-22WT or the mutant version unc22C11G). The next number (#min) is indication of the time of incubation for the experiment and this is either followed by #pcr_AF_SOL_# or just AF_SOL_#. If followed by #pcr, that is the indication of the number of PCR cycles used in the experiments. Finally, AF_SOL_# denotes the sequencing run ID number.
2014-11-14 | E-GEOD-58426 | biostudies-arrayexpress