A MarR Family Transcriptional Regulator, DptR3, Activates Daptomycin Biosynthesis and Morphological Differentiation in Streptomyces roseosporus.

ABSTRACT: Daptomycin produced by Streptomyces roseosporus is an important lipopeptide antibiotic used to treat human infections caused by Gram-positive pathogenic bacteria, including drug-resistant strains. The genetic basis for regulatory mechanisms of daptomycin production is poorly known. Here, we characterized the dptR3 gene, which encodes a MarR family transcriptional regulator located adjacent to the known daptomycin biosynthetic (dpt) genes. Deletion of dptR3 reduced daptomycin production significantly and delayed aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of DptR3 in daptomycin production revealed that it stimulates daptomycin production indirectly by altering the transcription of dpt structural genes. DptR3 directly activated the transcription of its own gene, dptR3, but repressed the transcription of the adjacent, divergent gene orf16 (which encodes a putative ABC transporter ATP-binding protein). A 66-nucleotide DptR3-binding site in the intergenic region of dptR3-orf16 was determined by DNase I footprinting, and the palindromic sequence TCATTGTTACCTATGCTCACAATGA (underlining indicates inverted repeats) in the protected region was found to be essential for DptR3 binding. orf16, the major target gene of DptR3, exerted a positive effect on daptomycin biosynthesis. Our findings indicate that DptR3 functions as a global regulator that positively controls daptomycin production and morphological development in S. roseosporus.

SUBMITTER: Zhang Q 

PROVIDER: S-EPMC4421045 | biostudies-literature | 2015 Jun

REPOSITORIES: biostudies-literature