Browse
Submit Data
Databases
API
Help

Dataset Information

26 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Molecular cloning and physical mapping of the daptomycin gene cluster from Streptomyces roseosporus.

ABSTRACT: The daptomycin biosynthetic gene cluster of Streptomyces roseosporus was analyzed by Tn5099 mutagenesis, molecular cloning, partial DNA sequencing, and insertional mutagenesis with cloned segments of DNA. The daptomycin biosynthetic gene cluster spans at least 50 kb and is located about 400 to 500 kb from one end of the approximately 7,100-kb linear chromosome. We identified two peptide synthetase coding regions interrupted by a 10- to 20-kb region that may encode other functions in lipopeptide biosynthesis.

SUBMITTER: Mchenney MA

PROVIDER: S-EPMC106860 | biostudies-literature | 1998 Jan

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Molecular cloning and physical mapping of the daptomycin gene cluster from Streptomyces roseosporus.

Mchenney M A MA Hosted T J TJ Dehoff B S BS Rosteck P R PR Baltz R H RH

Journal of bacteriology 19980101 1

The daptomycin biosynthetic gene cluster of Streptomyces roseosporus was analyzed by Tn5099 mutagenesis, molecular cloning, partial DNA sequencing, and insertional mutagenesis with cloned segments of DNA. The daptomycin biosynthetic gene cluster spans at least 50 kb and is located about 400 to 500 kb from one end of the approximately 7,100-kb linear chromosome. We identified two peptide synthetase coding regions interrupted by a 10- to 20-kb region that may encode other functions in lipopeptide ...[more]

PMID: 9422604

Similar Datasets

Transcriptional regulation of the daptomycin gene cluster in Streptomyces roseosporus by an autoregulator, AtrA.

Project description:Daptomycin is a cyclic lipopeptide antibiotic produced by Streptomyces roseosporus. To reveal the transcriptional regulatory mechanism of daptomycin biosynthesis, we used the biotinylated dptE promoter (dptEp) as a probe to affinity isolate the dptEp-interactive protein AtrA, a TetR family transcriptional regulator, from the proteome of mycelia. AtrA bound directly to dptEp to positively regulate gene cluster expression and daptomycin production. Meanwhile, both ΔatrA and ΔadpA mutants showed bald phenotype and null production of daptomycin. AdpA positively regulated atrA expression by direct interaction with atrA promoter (atrAp), and removal of ArpA in S. roseosporus, a homolog of the A-factor receptor, resulted in accelerated morphological development and increased daptomycin production, suggesting that atrA was the target of AdpA to mediate the A-factor signaling pathway. Furthermore, AtrA was positively autoregulated by binding to its own promoter atrAp. Thus, for the first time at the transcriptional level, we have identified an autoregulator, AtrA, that directly mediates the A-factor signaling pathway to regulate the proper production of daptomycin.

| S-EPMC4367297 | biostudies-literature

m4C DNA methylation regulates biosynthesis of daptomycin in <i>Streptomyces roseosporus</i> L30.

Project description:Despite numerous studies on transcriptional level regulation by single genes in drug producing Actinomyces, the global regulation based on epigenetic modification is not well explored. N4-methylcytosine (m4C), an abundant epigenetic marker in Actinomycetes' genome, but its regulatory mechanism remains unclear. In this study, we identify a m4C methyltransferase (SroLm3) in Streptomyces roseosporus L30 and multi-omics studies were performed and revealed SroLm3 as a global regulator of secondary metabolism. Notably, three BGCs in ΔsroLm3 strain exhibited decreased expression compared to wild type. In-frame deletion of sroLm3 in S.roseosporus L30 further revealed its role in enhancing daptomycin production. In summary, we characterized a m4C methyltransferase, revealed the function of m4C in secondary metabolism regulation and biosynthesis of red pigment, and mapped a series of novel regulators for daptomycin biosynthesis dominated by m4C methylation. Our research further indicated that m4C DNA methylation may contribute to a metabolic switch from primary to secondary metabolism in Actinomyces.

| S-EPMC9240718 | biostudies-literature

A MarR Family Transcriptional Regulator, DptR3, Activates Daptomycin Biosynthesis and Morphological Differentiation in Streptomyces roseosporus.

Project description:Daptomycin produced by Streptomyces roseosporus is an important lipopeptide antibiotic used to treat human infections caused by Gram-positive pathogenic bacteria, including drug-resistant strains. The genetic basis for regulatory mechanisms of daptomycin production is poorly known. Here, we characterized the dptR3 gene, which encodes a MarR family transcriptional regulator located adjacent to the known daptomycin biosynthetic (dpt) genes. Deletion of dptR3 reduced daptomycin production significantly and delayed aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of DptR3 in daptomycin production revealed that it stimulates daptomycin production indirectly by altering the transcription of dpt structural genes. DptR3 directly activated the transcription of its own gene, dptR3, but repressed the transcription of the adjacent, divergent gene orf16 (which encodes a putative ABC transporter ATP-binding protein). A 66-nucleotide DptR3-binding site in the intergenic region of dptR3-orf16 was determined by DNase I footprinting, and the palindromic sequence TCATTGTTACCTATGCTCACAATGA (underlining indicates inverted repeats) in the protected region was found to be essential for DptR3 binding. orf16, the major target gene of DptR3, exerted a positive effect on daptomycin biosynthesis. Our findings indicate that DptR3 functions as a global regulator that positively controls daptomycin production and morphological development in S. roseosporus.

| S-EPMC4421045 | biostudies-literature

Molecular cloning and identification of the laspartomycin biosynthetic gene cluster from Streptomyces viridochromogenes.

Project description:The biosynthetic gene cluster for laspartomycins, a family of 11 amino acid peptide antibiotics, has been cloned and sequenced from Streptomyces viridochromogenes ATCC 29814. Annotation of a segment of 88912bp of S. viridochromogenes genomic sequence revealed the putative lpm cluster and its flanking regions which harbor 43 open reading frames. The lpm cluster, which spans approximately 60 kb, consists of 21 open reading frames. Those include four NRPS genes (lpmA/orf18, lpmB/orf25, lpmC/orf26 and lpmD/orf27), four genes (orfs 21, 22, 24 and 29) involved in the lipid tail biosynthesis and attachment, four regulatory genes (orfs 13, 19, 32 and 33) and three putative exporters or self-resistance genes (orfs 14, 20 and 30). In addition, the gene involved in the biosynthesis of the nonproteinogenic amino acid Pip was also identified in the lpm cluster while the genes necessary for the biosynthesis of the rare residue diaminopropionic acid (Dap) were found to reside elsewhere on the chromosome. Interestingly, the dabA, dabB and dabC genes predicted to code for the biosynthesis of the unusual amino acid diaminobutyric acid (Dab) are organized into the lpm cluster even though the Dab residue was not found in the laspartomycins. Disruption of the NRPS lpmC gene completely abolished laspartomycin production in the corresponding mutant strain. These findings will allow molecular engineering and combinatorial biosynthesis approaches to expand the structural diversity of the amphomycin-group peptide antibiotics including the laspartomycins and friulimicins.

| S-EPMC3391544 | biostudies-literature

DepR1, a TetR Family Transcriptional Regulator, Positively Regulates Daptomycin Production in an Industrial Producer, Streptomyces roseosporus SW0702.

Project description:Daptomycin is a potent cyclic lipopeptide antibiotic. It is widely used against various Gram-positive bacterial pathogens. Historically, a poor understanding of the transcriptional regulation of daptomycin biosynthesis has limited the options for targeted genetic engineering toward titer improvement. Here, we isolated a TetR family transcriptional regulator, DepR1, from the industrial producer Streptomyces roseosporus SW0702 using a biotinylated dptE promoter (dptEp) as a probe. The direct interaction between DepR1 and dptEp then was confirmed by electrophoretic mobility shift assays and DNase I footprinting assays. The deletion of depR1 led to a reduction in dptEp activity and the cessation of daptomycin production. The ΔdepR1 mutant produced less red pigment and failed to sporulate on R5 medium. This suggests that DepR1 plays a positive role in the control of morphological differentiation. Moreover, DepR1 was positively autoregulated by directly binding to its own promoter. This might account for the positive feedback regulation of daptomycin production. Based on these positive effects, genetic engineering by overexpression of depR1 raised daptomycin production and shortened the fermentation period both in flask and in fermentor.

| S-EPMC4784024 | biostudies-literature

Transcriptional Regulator DasR Represses Daptomycin Production through Both Direct and Cascade Mechanisms in <i>Streptomyces roseosporus</i>.

Project description:Daptomycin, produced by Streptomyces roseosporus, is a clinically important cyclic lipopeptide antibiotic used for the treatment of human infections caused by drug-resistant Gram-positive pathogens. In contrast to most Streptomyces antibiotic biosynthetic gene clusters (BGCs), daptomycin BGC has no cluster-situated regulator (CSR) genes. DasR, a GntR-family transcriptional regulator (TR) widely present in the genus, was shown to regulate antibiotic production in model species S. coelicolor by binding to promoter regions of CSR genes. New findings reported here reveal that DasR pleiotropically regulates production of daptomycin and reddish pigment, and morphological development in S. roseosporus. dasR deletion enhanced daptomycin production and morphological development, but reduced pigment production. DasR inhibited daptomycin production by directly repressing dpt structural genes and global regulatory gene adpA (whose product AdpA protein activates daptomycin production and morphological development). DasR-protected regions on dptEp and adpAp contained a 16 nt sequence similar to the consensus DasR-binding site dre in S. coelicolor. AdpA was shown to target dpt structural genes and dptR2 (which encodes a DeoR-family TR required for daptomycin production). A 10 nt sequence similar to the consensus AdpA-binding site was found on target promoter regions dptAp and dptR2p. This is the first demonstration that DasR regulates antibiotic production both directly and through a cascade mechanism. The findings expand our limited knowledge of the regulatory network underlying daptomycin production, and will facilitate methods for construction of daptomycin overproducers.

| S-EPMC9404778 | biostudies-literature

MS/MS-based networking and peptidogenomics guided genome mining revealed the stenothricin gene cluster in Streptomyces roseosporus.

Project description:Most (75%) of the anti-infectives that save countless lives and enormously improve quality of life originate from microbes found in nature. Herein, we described a global visualization of the detectable molecules produced from a single microorganism, which we define as the 'molecular network' of that organism, followed by studies to characterize the cellular effects of antibacterial molecules. We demonstrate that Streptomyces roseosporus produces at least four non-ribosomal peptide synthetase-derived molecular families and their gene subnetworks (daptomycin, arylomycin, napsamycin and stenothricin) were identified with different modes of action. A number of previously unreported analogs involving truncation, glycosylation, hydrolysis and biosynthetic intermediates and/or shunt products were also captured and visualized by creation of a map through MS/MS networking. The diversity of antibacterial compounds produced by S. roseosporus highlights the importance of developing new approaches to characterize the molecular capacity of an organism in a more global manner. This allows one to more deeply interrogate the biosynthetic capacities of microorganisms with the goal to streamline the discovery pipeline for biotechnological applications in agriculture and medicine. This is a contribution to a special issue to honor Chris Walsh's amazing career.

| S-EPMC3919142 | biostudies-literature

Identification of novel mureidomycin analogues via rational activation of a cryptic gene cluster in Streptomyces roseosporus NRRL 15998.

Project description:Antimicrobial agents are urgently needed to tackle the growing threat of antibiotic-resistant pathogens. An important source of new antimicrobials is the large repertoire of cryptic gene clusters embedded in microbial genomes. Genome mining revealed a napsamycin/mureidomycin biosynthetic gene cluster in the chromosome of Streptomyces roseosporus NRRL 15998. The cryptic gene cluster was activated by constitutive expression of a foreign activator gene ssaA from sansanmycin biosynthetic gene cluster of Streptomyces sp. strain SS. Expression of the gene cluster was verified by RT-PCR analysis of key biosynthetic genes. The activated metabolites demonstrated potent inhibitory activity against the highly refractory pathogen Pseudomonas aeruginosa, and characterization of the metabolites led to the discovery of eight acetylated mureidomycin analogues. To our surprise, constitutive expression of the native activator gene SSGG_02995, a ssaA homologue in S. roseosporus NRRL 15998, has no beneficial effect on mureidomycin stimulation. This study provides a new way to activate cryptic gene cluster for the acquisition of novel antibiotics and will accelerate the exploitation of prodigious natural products in Streptomyces.

| S-EPMC4572928 | biostudies-literature

Molecular mechanism of mureidomycin biosynthesis activated by introduction of an exogenous regulatory gene ssaA into Streptomyces roseosporus.

Project description:Mureidomycins (MRDs), a group of unique uridyl-peptide antibiotics, exhibit antibacterial activity against the highly refractory pathogen Pseudomonas aeruginosa. Our previous study showed that the cryptic MRD biosynthetic gene cluster (BGC) mrd in Streptomyces roseosporus NRRL 15998 could not be activated by its endogenous regulator 02995 but activated by an exogenous activator SsaA from sansanmycin's BGC ssa of Streptomyces sp. strain SS. Here we report the molecular mechanism for this inexplicable regulation. EMSAs and footprinting experiments revealed that SsaA could directly bind to a 14-nt palindrome sequence of 5'-CTGRCNNNNGTCAG-3' within six promoter regions of mrd. Disruption of three representative target genes (SSGG-02981, SSGG-02987 and SSGG-02994) showed that the target genes directly controlled by SsaA were essential for MRD production. The regulatory function was further investigated by replacing six regions of SSGG-02995 with those of ssaA. Surprisingly, only the replacement of 343-450 nt fragment encoding the 115-150 amino acids (AA) of SsaA could activate MRD biosynthesis. Further bioinformatics analysis showed that the 115-150 AA situated between two conserved domains of SsaA. Our findings significantly demonstrate that constitutive expression of a homologous exogenous regulatory gene is an effective strategy to awaken cryptic biosynthetic pathways in Streptomyces.

| S-EPMC7880210 | biostudies-literature

Molecular cloning, sequence analysis, and heterologous expression of the phosphinothricin tripeptide biosynthetic gene cluster from Streptomyces viridochromogenes DSM 40736.

Project description:A fosmid library from genomic DNA of Streptomyces viridochromogenes DSM 40736 was constructed and screened for the presence of genes known to be involved in the biosynthesis of phosphinothricin tripeptide (PTT). Eight positives were identified, one of which was able to confer PTT biosynthetic capability upon Streptomyces lividans after integration of the fosmid into the chromosome of this heterologous host. Sequence analysis of the 40,241-bp fosmid insert revealed 29 complete open reading frames (ORFs). Deletion analysis demonstrated that a minimum set of 24 ORFs were required for PTT production in the heterologous host. Sequence analysis revealed that most of these PTT genes have been previously identified in either S. viridochromogenes or S. hygroscopicus (or both), although only 11 out of 24 of these ORFs have experimentally defined functions. Three previously unknown genes within the cluster were identified and are likely to have roles in the stepwise production of phosphonoformate from phosphonoacetaldehyde. This is the first report detailing the entire PTT gene cluster from any producing streptomycete.

| S-EPMC538901 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data