Peptide aptamers: development and applications.
Ontology highlight
ABSTRACT:
SUBMITTER: Reverdatto S
PROVIDER: S-EPMC4428161 | biostudies-literature | 2015
REPOSITORIES: biostudies-literature
Publications
Peptide aptamers: development and applications.
Reverdatto Sergey S Burz David S DS Shekhtman Alexander A
Current topics in medicinal chemistry 20150101 12
Peptide aptamers are small combinatorial proteins that are selected to bind to specific sites on their target molecules. Peptide aptamers consist of short, 5-20 amino acid residues long sequences, typically embedded as a loop within a stable protein scaffold. Various peptide aptamer scaffolds and in vitro and in vivo selection techniques are reviewed with emphasis on specific biomedical, bioimaging, and bioanalytical applications. ...[more]
Similar Datasets
Project description:Guanine (G)-quadruplexes (G4s) are unique nucleic acid structures that are formed by stacked G-tetrads in G-rich DNA or RNA sequences. G4s have been reported to play significant roles in various cellular events in both macro- and micro-organisms. The identification and characterization of G4s can help to understand their different biological roles and potential applications in diagnosis and therapy. In addition to biophysical and biochemical methods to interrogate G4 formation, G4 fluorescent turn-on ligands can be used to target and visualize G4 formation both in vitro and in cells. Here, we review several representative classes of G4 fluorescent turn-on ligands in terms of their interaction mechanism and application perspectives. Interestingly, G4 structures are commonly identified in DNA and RNA aptamers against targets that include proteins and small molecules, which can be utilized as G4 tools for diverse applications. We therefore also summarize the recent development of G4-containing aptamers and highlight their applications in biosensing, bioimaging, and therapy. Moreover, we discuss the current challenges and future perspectives of G4 fluorescent turn-on ligands and G4-containing aptamers.
| S-EPMC6650947 | biostudies-literature
Project description:Nucleic acid aptamers show clear promise as diagnostic reagents, as highly specific strands were reported against a large variety of biomarkers. They have appealing benefits in terms of reproducible generation by chemical synthesis, controlled modification with labels and functionalities providing versatile means for detection and oriented immobilization, as along with high biochemical and temperature resistance. Aptamers against immunoglobulin targets-IgA, IgM, IgG and IgE-have a clear niche for diagnostic applications, therefore numerous aptamers have been selected and used in combination with a variety of detection techniques. The aim of this review is to overview and evaluate aptamers selected for the recognition of antibodies, in terms of their design, analytical properties and diagnostic applications. Aptamer candidates showed convincing performance among others to identify stress and upper respiratory tract infection through SIgA detection, for cancer cell recognition using membrane bound IgM, to detect and treat hemolytic transfusion reactions, autoimmune diseases with IgG and detection of IgE for allergy diseases. However, in general, their use still lags significantly behind what their claimed benefits and the plethora of application opportunities would forecast.
| S-EPMC7461046 | biostudies-literature
Project description:G-quadruplexes constitute a unique class of nucleic acid structures formed by G-rich oligonucleotides of DNA- or RNA-type. Depending on their chemical nature, loops length, and localization in the sequence or structure molecularity, G-quadruplexes are highly polymorphic structures showing various folding topologies. They may be formed in the human genome where they are believed to play a pivotal role in the regulation of multiple biological processes such as replication, transcription, and translation. Thus, natural G-quadruplex structures became prospective targets for disease treatment. The fast development of systematic evolution of ligands by exponential enrichment (SELEX) technologies provided a number of G-rich aptamers revealing the potential of G-quadruplex structures as a promising molecular tool targeted toward various biologically important ligands. Because of their high stability, increased cellular uptake, ease of chemical modification, minor production costs, and convenient storage, G-rich aptamers became interesting therapeutic and diagnostic alternatives to antibodies. In this review, we describe the recent advances in the development of G-quadruplex based aptamers by focusing on the therapeutic and diagnostic potential of this exceptional class of nucleic acid structures.
| S-EPMC6832456 | biostudies-literature
Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.
2019-09-30 | GSE124865 | GEO
Project description:Aptamers are a special class of nucleic acid molecules that are beginning to be investigated for clinical use. These small RNA/DNA molecules can form secondary and tertiary structures capable of specifically binding proteins or other cellular targets; they are essentially a chemical equivalent of antibodies. Aptamers have the advantage of being highly specific, relatively small in size, and non-immunogenic. Since the discovery of aptamers in the early 1990s, great efforts have been made to make them clinically relevant for diseases like cancer, HIV, and macular degeneration. In the last two decades, many aptamers have been clinically developed as inhibitors for targets such as vascular endothelial growth factor (VEGF) and thrombin. The first aptamer based therapeutic was FDA approved in 2004 for the treatment of age-related macular degeneration and several other aptamers are currently being evaluated in clinical trials. With advances in targeted-therapy, imaging, and nanotechnology, aptamers are readily considered as potential targeting ligands because of their chemical synthesis and ease of modification for conjugation. Preclinical studies using aptamer-siRNA chimeras and aptamer targeted nanoparticle therapeutics have been very successful in mouse models of cancer and HIV. In summary aptamers are in several stages of development, from pre-clinical studies to clinical trials and even as FDA approved therapeutics. In this review, we will discuss the current state of aptamers in clinical trials as well as some promising aptamers in pre-clinical development.
| S-EPMC3260938 | biostudies-literature
Project description:Aptamers are single-stranded oligonucleotides with high affinity and specificity to the target molecules or cells, thus they can serve as an important category of molecular targeting ligand. Since their discovery, aptamers have been rapidly translated into clinical practice. The strong target affinity/selectivity, cost-effectivity, chemical versatility and safety of aptamers are superior to traditional peptides- or proteins-based ligands which make them unique choices for molecular imaging. Therefore, aptamers are considered to be extremely useful to guide various imaging contrast agents to the target tissues or cells for optical, magnetic resonance, nuclear, computed tomography, ultrasound and multimodality imaging. This review aims to provide an overview of aptamers' advantages as targeting ligands and their application in targeted imaging. Further research in synthesis of new types of aptamers and their conjugation with new categories of contrast agents is required to develop clinically translatable aptamer-based imaging agents which will eventually result in improved patient care.
| S-EPMC4410081 | biostudies-literature
Project description:The cellular functions of RNA are not limited to their role as blueprints for protein synthesis. In particular, noncoding RNA, such as, snRNAs, lncRNAs, miRNAs, play important roles. With increasing numbers of RNAs being identified, it is well known that the transcriptome outnumbers the proteome by far. This emphasizes the great importance of functional RNA characterization and the need to further develop tools for these investigations, many of which are still in their infancy. Fluorescent light-up aptamers (FLAPs) are RNA sequences that can bind nontoxic, cell-permeable small-molecule fluorogens and enhance their fluorescence over many orders of magnitude upon binding. FLAPs can be encoded on the DNA level using standard molecular biology tools and are subsequently transcribed into RNA by the cellular machinery, so that they can be used as fluorescent RNA tags (FLAP-tags). In this Minireview, we give a brief overview of the fluorogens that have been developed and their binding RNA aptamers, with a special focus on published crystal structures. A summary of current and future cellular FLAP applications with an emphasis on the study of RNA-RNA and RNA-protein interactions using split-FLAP and Förster resonance energy transfer (FRET) systems is given.
| S-EPMC6391945 | biostudies-literature
Project description:The utilization of structure-switching aptamers (SSAs) has enabled the development of novel sensing platforms for the sensitive and continuous detection of molecules. De novo development of SSAs, however, is complex and laborious. Here we describe a rational approach to SSA optimization that simultaneously improves aptamer binding affinity and introduces target-dependent conformation-switching for compatibility with real-world biosensor applications. Key structural features identified from NMR and computational modeling were used to optimize conformational switching in the presence of target, while large-scale, microarray-based mutation analysis was used to map regions of the aptamer permissive to mutation and identify combinations of mutations with stronger binding affinity. Optimizations were carried out in a relevant biofluid to ensure a seamless transition of the aptamer to a biosensing platform. Initial proof-of-concept for this approach is demonstrated with a cortisol binding aptamer but can easily be translated to other relevant aptamers. Cortisol is a hormone correlated with the stress response that has been associated with various medical conditions and is present at quantifiable levels in accessible biofluids. The ability to continuously track levels of stress in real-time via cortisol monitoring, which can be enabled by the aptamers reported here, is crucial for assessing human health and performance.
| S-EPMC10897929 | biostudies-literature
Project description:We present a remodeling method for high-affinity unnatural-base DNA aptamers to augment their thermal stability and nuclease resistance, for use as drug candidates targeting specific proteins. Introducing a unique mini-hairpin DNA provides robust stability to unnatural-base DNA aptamers generated by SELEX using genetic alphabet expansion, without reducing their high affinity. By this method, >80% of the remodeled DNA aptamer targeting interferon-? (KD of 33 pM) survived in human serum at 37?°C after 3 days under our experimental conditions, and sustainably inhibited the biological activity of interferon-?.
| S-EPMC4686876 | biostudies-literature
Project description:Breast cancer is one of the most common causes of cancer related deaths in women. Currently, with the development of early detection, increased social awareness and kinds of treatment options, survival rate has improved in nearly every type of breast cancer patients. However, about one third patients still have increased chances of recurrence within five years and the five-year relative survival rate in patients with metastasis is less than 30%. Breast cancer contains multiple subtypes. Each subtype could cause distinct clinical outcomes and systemic interventions. Thereby, new targeted therapies are of particular importance to solve this major clinical problem. Aptamers, often termed "chemical antibodies", are functionally similar to antibodies and have demonstrated their superiority of recognizing target with high selectivity, affinity and stability. With these intrinsic properties, aptamers have been widely studied in cancer biology and some are in clinical trials. In this review, we will firstly discuss about the global impacts and mechanisms of breast cancer, then briefly highlight applications of aptamers that have been developed for breast cancer and finally summarize various challenges in clinical translation of aptamers.
| S-EPMC5618500 | biostudies-literature