Dataset Information

Phytoene Desaturase from Oryza sativa: Oligomeric Assembly, Membrane Association and Preliminary 3D-Analysis.

ABSTRACT: Recombinant phytoene desaturase (PDS-His6) from rice was purified to near-homogeneity and shown to be enzymatically active in a biphasic, liposome-based assay system. The protein contains FAD as the sole protein-bound redox-cofactor. Benzoquinones, not replaceable by molecular oxygen, serve as a final electron acceptor defining PDS as a 15-cis-phytoene (donor):plastoquinone oxidoreductase. The herbicidal PDS-inhibitor norflurazon is capable of arresting the reaction by stabilizing the intermediary FAD(red), while an excess of the quinone acceptor relieves this blockage, indicating competition. The enzyme requires its homo-oligomeric association for activity. The sum of data collected through gel permeation chromatography, non-denaturing polyacrylamide electrophoresis, chemical cross-linking, mass spectrometry and electron microscopy techniques indicate that the high-order oligomers formed in solution are the basis for an active preparation. Of these, a tetramer consisting of dimers represents the active unit. This is corroborated by our preliminary X-ray structural analysis that also revealed similarities of the protein fold with the sequence-inhomologous bacterial phytoene desaturase CRTI and other oxidoreductases of the GR2-family of flavoproteins. This points to an evolutionary relatedness of CRTI and PDS yielding different carotene desaturation sequences based on homologous protein folds.

SUBMITTER: Gemmecker S

PROVIDER: S-EPMC4492965 | biostudies-literature | 2015

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Phytoene Desaturase from Oryza sativa: Oligomeric Assembly, Membrane Association and Preliminary 3D-Analysis.

Gemmecker Sandra S Schaub Patrick P Koschmieder Julian J Brausemann Anton A Drepper Friedel F Rodriguez-Franco Marta M Ghisla Sandro S Warscheid Bettina B Einsle Oliver O Beyer Peter P

PloS one 20150706 7

Recombinant phytoene desaturase (PDS-His6) from rice was purified to near-homogeneity and shown to be enzymatically active in a biphasic, liposome-based assay system. The protein contains FAD as the sole protein-bound redox-cofactor. Benzoquinones, not replaceable by molecular oxygen, serve as a final electron acceptor defining PDS as a 15-cis-phytoene (donor):plastoquinone oxidoreductase. The herbicidal PDS-inhibitor norflurazon is capable of arresting the reaction by stabilizing the intermedia ...[more]

PMID: 26147209

Similar Datasets

Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').

Project description:CRISPR/Cas9 has become a powerful genome-editing tool for introducing genetic changes into crop species. In order to develop capacity for CRISPR/Cas9 technology in the tropical staple cassava (Manihot esculenta), the Phytoene desaturase (MePDS) gene was targeted in two cultivars using constructs carrying gRNAs targeting two sequences within MePDS exon 13. After Agrobacterium-mediated delivery of CRISPR/Cas9 reagents into cassava cells, both constructs induced visible albino phenotypes within cotyledon-stage somatic embryos regenerating on selection medium and the plants regenerated therefrom. A total of 58 (cv. 60444) and 25 (cv. TME 204) plant lines were recovered, of which 38 plant lines (19 from each cultivar) were analyzed for mutagenesis. The frequency of plant lines showing albino phenotype was high, ranging from 90 to 100% in cv. TME 204. Observed albino phenotypes were comprised of full albinos devoid of green tissue and chimeras containing a mixture of white and green tissues. Sequence analysis revealed that 38/38 (100%) of the plant lines examined carried mutations at the targeted MePDS site, with insertions, deletions, and substitutions recorded. One putatively mono-allelic homozygous line (1/19) was found from cv. 60444, while 1 (1/19) and 4 (4/19) putatively bi-allelic homozygous lines were found in 60444 and TME204, respectively. The remaining plant lines, comprised mostly of the chimeras, were found to be putatively heterozygous. We observed minor (1 bp) nucleotide substitutions and or deletions upstream of the 5' and or downstream of the 3' targeted MePDS region. The data reported demonstrates that CRISPR/Cas9-mediated genome editing of cassava is highly efficient and relatively simple, generating multi-allelic mutations in both cultivars studied. Modification of MePDS described here generates visually detectable mutated events in a relatively short time frame of 6-8 weeks, and does not require sequencing to confirm editing at the target. It therefore provides a valuable platform to facilitate rapid assessment and optimization of CRISPR/Cas9 and other genome-editing technologies in cassava.

Dataset Information

Phytoene Desaturase from Oryza sativa: Oligomeric Assembly, Membrane Association and Preliminary 3D-Analysis.

Publications

Phytoene Desaturase from Oryza sativa: Oligomeric Assembly, Membrane Association and Preliminary 3D-Analysis.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets