Preliminary exploration of Oryza sativa small RNAs - Run 1 and 2
Ontology highlight
ABSTRACT:
ORGANISM(S): Oryza sativa
PROVIDER: GSE16248 | GEO | 2009/06/08
SECONDARY ACCESSION(S): PRJNA115187
REPOSITORIES: GEO
Similar Datasets
Project description:The small RNAs presented here were produced as a preliminary exploration of small RNAs in rice, and as such, various tissues and stress conditions were sampled. Small RNAs present in these samples were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. The datasets contain Oryza sativa var Nipponbar endogenous small RNA sequences in the size range 18 to 34 nt. Plants were grown in a Conviron Environmental Chamber at high light intensity using both high pressure sodium and metal halide lamps for 10.5 hr at 28 degrees C and for 13.5 hr at 26 degrees C in the dark. RNA was extracted from rice tissues at various stages of development and under different abiotic and biotic stresses. The small RNAs presented here were all mapped to the rice genome TIGR version 5. The total number of distinct mapped sequences are 12879 for Run 1 and 88508 for Run 2. The total number of sequence reads were respectively 70406 and 191682. Run 1: A small RNA library was generated from whole cell RNA isolated from inflorescence, 30 and 60 day leaves, 10 and 25 day seedlings and from seedling polysomes using Bartel primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). This was combined with a library derived from whole cell RNA isolated from 30 and 60 day leaves and 10 and 25 day seedlings using Bartel A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Run 2: Mixed tissues from unstressed plants. Library prepared from equal amounts of adult root, adult stem and inflorescence from unstressed plants. Amplified with Standard primers (5' ATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAAT 3'). Seedlings stressed by cold, salt desiccation, heat and dark. Tissues were mixed in a 2:2:1:1:1:1 ratio. Amplified with A primers (5' AGCTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATACTG 3'). Kinase library. RNA was isolated from tissues used in 'Adult whole plant' (~30%), 'Stressed' (~25%), from unstressed seedlings of various ages (~15%) from 30 and 60 day leaves (20%) and from immature inflorescence (~10%). RNA isolated from tissues from unstressed plants were treated with polynucleotide kinase before second ligation. This eliminates the dependence of a 5` phosphate as for all the other libraries. Amplified with B primers (5' CAGTATCGTAGGCACCTGAAA - smRNA - CTGTAGGCACCATCAATAGCT 3').
2009-06-07 | E-GEOD-16248 | biostudies-arrayexpress
Project description:To address the role of small regulatory RNAs in rice development, we generated a large data set of small RNAs from root apices (RoApx), shoot apices (ShApx), developing inflorescence (Infl) and mature leaf (Leaf). These tissues were chosen because they are expected to be rich in small RNAs and display different patterns of small RNA expression. The RoApx, ShApx, and Infl samples are expected to be enriched for meristematic tissues each of which have different fates. The Infl sample would also be expected to contain developing female gametes. In contrast, the Leaf sample is terminally differentiated and may be expected to be more transcriptionally repressed. These small RNAs comprise a total of 781,885 distinct sequences, and all of these map to at least one locus of the rice genome TIGR version 5.
2009-06-08 | GSE16350 | GEO
Project description:ADARs regulate small RNAs mapped to edited sequences
| PRJNA353119 | ENA
Project description:Transcription from 23K TIGR-loci were confirmed by full-length cDNA mapping, but other 33K TIGR-loci were not confirmed. However, it was not natural to think that full-length cDNA libraries was included almost rice genes, because the transcription of 3K CDS-ANE were confirmed by other transcriptome resources in TIGR OSA1. So, for detection of gene expression from FL-locus and TIGR-locus, we designed about 82K 60mer oligo probes based on TIGR Pseudomolecules release 2. However, TIGR-locus was revised according to revised Pseudomolecules and other additional transcriptome resources. Therefore designed 82K probes were re-mapped on TIGR4 ,and 63455 probes were mapped on 43090 locus Keywords: tissue type comparison
2007-11-28 | GSE7374 | GEO
Project description:Transcription from 23K TIGR–loci were confirmed by full–length cDNA mapping, but other 33K TIGR–loci were not confirmed. However, it was not natural to think that full–length cDNA libraries was included almost rice genes, because the transcription of 3K CDS–ANE were confirmed by other transcriptome resources in TIGR OSA1. So, for detection of gene expression from FL–locus and TIGR–locus, we designed about 82K 60mer oligo probes based on TIGR Pseudomolecules release 2. However, TIGR–locus was revised according to revised Pseudomolecules and other additional transcriptome resources. Therefore designed 82K probes were re-mapped on TIGR4 ,and 63455 probes were mapped on 43090 locus Keywords: tissue type comparison
2007-11-28 | GSE7366 | GEO
Project description:Identification of all expressed transcripts in a sequenced complex genome is technically challenging, but essential for systems biology and genome analysis. We used the transcriptional profiling technology called ‘massively parallel signature sequencing’ (MPSS) to develop a comprehensive expression atlas of rice (Oryza sativa cv Nipponbare). A total of 46,971,553 mRNA transcripts from 22 libraries, and 2,953,855 small RNAs from three libraries were sequenced. The data demonstrated widespread transcription throughout the genome, including expression for up to 25,500 annotated genes and antisense expression for nearly 9,000 annotated genes. An additional set of ~15,000 mRNA signatures mapped to unannotated genomic regions. The majority of the small RNA data represented lower abundance small-interfering RNAs (siRNAs) that match repetitive sequences, intergenic regions, and genes. Among these, numerous clusters of highly-regulated small RNAs were readily observed. We developed a genome browser (http://mpss.udel.edu/rice) for public access to the transcriptional profiling data for this important crop plant. Keywords: MPSS, mRNA, small RNA, transcriptome, rice
2007-02-23 | GSE7107 | GEO
Project description:Endogenous small RNAs, including microRNAs (miRNAs) and short-interfering RNAs (siRNAs), function as posttranscriptional or transcriptional regulators in plants. miRNA function is essential for normal development and therefore likely to be important in the growth of the rice grain. To investigate the likely roles of miRNAs in rice grain development we carried out deep sequencing of the small RNA populations of rice grains. A total of 96,091 (including 23,867 reads from vegetative tissues) and 5,379,724 small RNA sequences that are longer than 17nt were generated. Approximately 94% of these small RNAs were 20-24nt in length. The majority of the small RNAs were singletons, indicating that rice genome has a very complex small RNA population, which is harder to be saturated. From these smal RNA sequences we found representatives of all 20 conserved plant miRNA families and evidence for changes in expression of miRNAs during rice grain development. Using an approach based on the presence of the miRNA and miRNA* sequences, we identified 51 novel, non-conserved rice miRNA families expressed in grains with functionally diverse predicted target genes. miRNA-guided cleavage was confirmed for a number of targets genes including ones with roles in sugar signalling and restoration of cytoplasmic male sterility. We identified a likely mirtron, indicating that plants can also use spliced introns as a source of miRNAs. Our sequencing results revealed four TAS3 loci; these all contain dual miR390 sites of which only the 3? site is cleaved. We also found a miRNA-like long hairpin generating phased 21nt small RNAs, strongly expressed in developing grains and show that these small RNAs act in trans to cleave target mRNAs. Keywords: high throughput pyrosequencing, small RNA, microRNA, grain development, rice
2008-08-21 | GSE11014 | GEO
Project description:To address the role of small regulatory RNAs in rice development, we generated a large data set of small RNAs from root apices (RoApx), shoot apices (ShApx), developing inflorescence (Infl) and mature leaf (Leaf). These tissues were chosen because they are expected to be rich in small RNAs and display different patterns of small RNA expression. The RoApx, ShApx, and Infl samples are expected to be enriched for meristematic tissues each of which have different fates. The Infl sample would also be expected to contain developing female gametes. In contrast, the Leaf sample is terminally differentiated and may be expected to be more transcriptionally repressed. These small RNAs comprise a total of 781,885 distinct sequences, and all of these map to at least one locus of the rice genome TIGR version 5. Total RNA was extracted from root apices, shoot apices, developing inflorescence and mature leaf. Three samples from each tissue were taken to represent replicates and small RNAs from these were ligated to a common 5' RNA adapter and a replicate-specific 3' adapter. These replicate samples were then identified from within single 454 data sets using the 3' adapter sequence. It should be noted that there was a strong frequency bias observed between the RNA sequence and the particular 3' adapter used in the sequencing. This resulted in both increased or decreased read counts for the known miRNA sequences in a 3' adapter dependent fashion. Use of the three samples for each tissue as replicates is therefore problematic.
2009-06-07 | E-GEOD-16350 | biostudies-arrayexpress
Project description:Endogenous small RNAs, including microRNAs (miRNAs) and short-interfering RNAs (siRNAs), function as posttranscriptional or transcriptional regulators in plants. miRNA function is essential for normal development and therefore likely to be important in the growth of the rice grain. To investigate the likely roles of miRNAs in rice grain development we carried out deep sequencing of the small RNA populations of rice grains. A total of 96,091 (including 23,867 reads from vegetative tissues) and 5,379,724 small RNA sequences that are longer than 17nt were generated. Approximately 94% of these small RNAs were 20-24nt in length. The majority of the small RNAs were singletons, indicating that rice genome has a very complex small RNA population, which is harder to be saturated. From these smal RNA sequences we found representatives of all 20 conserved plant miRNA families and evidence for changes in expression of miRNAs during rice grain development. Using an approach based on the presence of the miRNA and miRNA* sequences, we identified 51 novel, non-conserved rice miRNA families expressed in grains with functionally diverse predicted target genes. miRNA-guided cleavage was confirmed for a number of targets genes including ones with roles in sugar signalling and restoration of cytoplasmic male sterility. We identified a likely mirtron, indicating that plants can also use spliced introns as a source of miRNAs. Our sequencing results revealed four TAS3 loci; these all contain dual miR390 sites of which only the 3? site is cleaved. We also found a miRNA-like long hairpin generating phased 21nt small RNAs, strongly expressed in developing grains and show that these small RNAs act in trans to cleave target mRNAs. Keywords: high throughput pyrosequencing, small RNA, microRNA, grain development, rice Small RNA populations of shoots and roots of 7 days old seedlings, and 1-5 and 6-10 days after fertilization grains were determined using high throughput sequencing technology. The abundance of known miRNAs were compared based on the number of sequence reads. To give a whole picture of the rice small RNA populations and to reflect un-biasly the sequencing results, small RNAs that are longer than 17nt no matter whether or not they matched with the rice genome were included in this submitted dataset. The unmatched sequences may be derived from un-sequenced regions or sequencing errors.
2008-08-21 | E-GEOD-11014 | biostudies-arrayexpress
Project description:Purpose: The goals of this study are to detect the small RNAs generated from the PMS1T gene and the cleavage sites mediated by small RNAs (microRNAs or phasiRNAs). Methods: The rice panicles were collected in liquid nitrogen and their total RNA were extracted for library construction and subsequent sequencing on an Illumina HiSeq 2000. Results: Using an optimized data analysis workflow, we mapped a series of small RNAs generated from the PMS1T region of the rice genome; most of these small RNAs were 21-nt phasiRNAs. The results from PARE sequencing validated the cleavage site on the PMS1T transcript, with the cleavage mediated by miR2118. Conclusions: Our results show that the 21-nt phasiRNA generated from the PMS1T transcript are associated with photoperiod-sensitive male sterility in rice.
2016-12-18 | GSE84885 | GEO