Dataset Information

20-HETE-induced mitochondrial superoxide production and inflammatory phenotype in vascular smooth muscle is prevented by glucose-6-phosphate dehydrogenase inhibition.

ABSTRACT: 20-Hydroxyeicosatetraeonic acid (20-HETE) produced by cytochrome P-450 monooxygenases in NADPH-dependent manner is proinflammatory, and it contributes to the pathogenesis of systemic and pulmonary hypertension. In this study, we tested the hypothesis that inhibition of glucose-6-phosphate dehydrogenase (G6PD), a major source of NADPH in the cell, prevents 20-HETE synthesis and 20-HETE-induced proinflammatory signaling that promotes secretory phenotype of vascular smooth muscle cells. Lipidomic analysis indicated that G6PD inhibition and knockdown decreased 20-HETE levels in pulmonary arteries as well as 20-HETE-induced 1) mitochondrial superoxide production, 2) activation of mitogen-activated protein kinase 1 and 3, 3) phosphorylation of ETS domain-containing protein Elk-1 that activate transcription of tumor necrosis factor-? gene (Tnfa), and 4) expression of tumor necrosis factor-? (TNF-?). Moreover, inhibition of G6PD increased protein kinase G1? activity, which, at least partially, mitigated superoxide production and Elk-1 and TNF-? expression. Additionally, we report here for the first time that 20-HETE repressed miR-143, which suppresses Elk-1 expression, and miR-133a, which is known to suppress synthetic/secretory phenotype of vascular smooth muscle cells. In summary, our findings indicate that 20-HETE elicited mitochondrial superoxide production and promoted secretory phenotype of vascular smooth muscle cells by activating MAPK1-Elk-1, all of which are blocked by inhibition of G6PD.

SUBMITTER: Lakhkar A

PROVIDER: S-EPMC4867393 | biostudies-literature | 2016 May

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

20-HETE-induced mitochondrial superoxide production and inflammatory phenotype in vascular smooth muscle is prevented by glucose-6-phosphate dehydrogenase inhibition.

Lakhkar Anand A Dhagia Vidhi V Joshi Sachindra Raj SR Gotlinger Katherine K Patel Dhara D Sun Dong D Wolin Michael S MS Schwartzman Michal L ML Gupte Sachin A SA

American journal of physiology. Heart and circulatory physiology 20160226 9

20-Hydroxyeicosatetraeonic acid (20-HETE) produced by cytochrome P-450 monooxygenases in NADPH-dependent manner is proinflammatory, and it contributes to the pathogenesis of systemic and pulmonary hypertension. In this study, we tested the hypothesis that inhibition of glucose-6-phosphate dehydrogenase (G6PD), a major source of NADPH in the cell, prevents 20-HETE synthesis and 20-HETE-induced proinflammatory signaling that promotes secretory phenotype of vascular smooth muscle cells. Lipidomic a ...[more]

PMID: 26921441

Similar Datasets

Project description:Glucose-6-phosphate dehydrogenase (G6PD) is the rate-limiting enzyme in the pentose phosphate pathway and a major source of nicotinamide adenine dinucleotide phosphate reduced (NADPH), which regulates numerous enzymatic (including glutathione reductase and NADPH oxidase that, respectively, generates reduced glutathione and reactive oxygen species) reactions involved in various cellular actions, yet its physiological function is seldom investigated. We, however, recently showed that inhibiting G6PD causes precontracted coronary artery (CA) to relax in an endothelium-derived relaxing factor- and second messenger-independent manner. Here we assessed the role of G6PD in regulating CA contractility. Treating bovine CAs for 20 min with potassium chloride (KCl; 30 mM), amphotericin B (50 ?M), or U46619 (100 nM) significantly (p < 0.05) increased both G6PD activity and glucose flux through the pentose phosphate pathway. The effect was Ca(2+) independent, and there was a corresponding increase in protein kinase C (PKC) activity. Activation of G6PD by KCl was blocked by the PKC? inhibitor rottlerin (10 ?M) or by knocking down PKC? expression using siRNA. Phorbol 12, 13-dibutyrate (10 ?M), a PKC activator, significantly increased G6PD phosphorylation and activity, whereas single (S210A, T266A) and double (S210A/T266A) mutations at sites flanking the G6PD active site significantly inhibited phosphorylation, shifted the isoelectric point, and reduced enzyme activity. Knocking down G6PD decreased NADPH and reactive oxygen species generation, and reduced KCl-evoked increases in [Ca(2+)](i) and myosin light chain phosphorylation, thereby reducing CA contractility. Similarly, aortas from G6PD-deficient mice developed less KCl/phorbol 12, 13-dibutyrate-evoked force than those from their wild-type littermates. Conversely, overexpression of G6PD augmented KCl-evoked increases in [Ca(2+)](i), thereby augmenting CA contraction. Our findings demonstrate that G6PD activity and NADPH is increased in activated CA in a PKC?-dependent manner and that G6PD modulates Ca(2+) entry and CA contractions evoked by membrane depolarization.

Project description:Purpose: Homeostatic control of vascular smooth muscle cell (VSMC) differentiation is critical for contractile activity and regulation of blood flow. Recently, we reported that pre-contracted blood vessels are relaxed and the phenotype of VSMC is regulated from a synthetic to contractile state by glucose-6-phosphate dehydrogenase (G6PD) inhibition. In the current study, we investigated whether the increase in the expression of VSMC contractile proteins by inhibition and knockdown of G6PD is mediated through a protein kinase G (PKG)-dependent pathway and whether it regulates blood pressure Methods: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500. The sequence reads that passed quality filters (Trimmomatic-0.32) were analyzed at the transcript isoform level using STAR_2.4.2a for mapping to reference GRCm38.p4 + Gencode-M6 Annotation and processed with Cufflinks-2.0.2. miR analysis was performed by quantitative RT-PCR (qRT-PCR) for validation using miR-specific TaqMan miR assays (Applied Biosystems, Foster City, CA). Quantitative PCR was performed in triplicate using TaqMan Universal PCR Master mix. Standard curves were made for each miR using synthetic miR oligonucleotides (IDT, Coralville, IA) with the following sequence: Rno-miR-145: GUCCAGUUUUCCCAGGAAUCCCU, Rno-miR-1: UGGAAUGUAAAGAAGUGUGUAU, Rno-miR-143: UGAGAUGAAGCACUGUAGCUC, Rno-miR-133a: UUUGGUCCCCUUCAACCAGCUG Results: We found that the expression of VSMC-restricted contractile proteins, myocardin (MYOCD), and miR-1 and miR-143 are increased by G6PD inhibition or knockdown. Importantly, RNA-sequence analysis of aortic tissue from G6PD-deficient mice revealed uniform increases in VSMC-restricted genes, particularly those regulated by the MYOCD-serum response factor (SRF) switch. Conversely, expression of Krüppel-like factor 4 (KLF4) is decreased by G6PD inhibition. Interestingly, the G6PD inhibition-induced expression of miR-1 and contractile proteins was blocked by Rp-β-phenyl-1,N2-etheno-8-bromo-guanosine-3’,5’-cyclic monophosphorothioate, a PKG inhibitor. On the other hand, MYOCD and miR-143 levels are increased by G6PD inhibition through a PKG-independent manner. Furthermore, blood pressure was lower in the G6PD-deficient as compared to wild-type mice Conclusions: Therefore, our results suggest that the expression of VSMC contractile proteins induced by G6PD inhibition occurs via PKG1-dependent and –independent pathways

Dataset Information

20-HETE-induced mitochondrial superoxide production and inflammatory phenotype in vascular smooth muscle is prevented by glucose-6-phosphate dehydrogenase inhibition.

Publications

20-HETE-induced mitochondrial superoxide production and inflammatory phenotype in vascular smooth muscle is prevented by glucose-6-phosphate dehydrogenase inhibition.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure