Browse
Submit Data
Databases
API
Help

Dataset Information

29 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Employing X-ray Photoelectron Spectroscopy for Determining Layer Homogeneity in Mixed Polar Self-Assembled Monolayers.

ABSTRACT: Self-assembled monolayers (SAMs) containing embedded dipolar groups offer the particular advantage of changing the electronic properties of a surface without affecting the SAM-ambient interface. Here we show that such systems can also be used for continuously tuning metal work functions by growing mixed monolayers consisting of molecules with different orientations of the embedded dipolar groups. To avoid injection hot-spots when using the SAM-modified electrodes in devices, a homogeneous mixing of the two components is crucial. We show that a combination of high-resolution X-ray photoelectron spectroscopy with state-of-the-art simulations is an ideal tool for probing the electrostatic homogeneity of the layers and thus for determining phase separation processes in polar adsorbate assemblies down to inhomogeneities at the molecular level.

SUBMITTER: Hehn I

PROVIDER: S-EPMC4976398 | biostudies-literature | 2016 Aug

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Employing X-ray Photoelectron Spectroscopy for Determining Layer Homogeneity in Mixed Polar Self-Assembled Monolayers.

Hehn Iris I Schuster Swen S Wächter Tobias T Abu-Husein Tarek T Terfort Andreas A Zharnikov Michael M Zojer Egbert E

The journal of physical chemistry letters 20160722 15

Self-assembled monolayers (SAMs) containing embedded dipolar groups offer the particular advantage of changing the electronic properties of a surface without affecting the SAM-ambient interface. Here we show that such systems can also be used for continuously tuning metal work functions by growing mixed monolayers consisting of molecules with different orientations of the embedded dipolar groups. To avoid injection hot-spots when using the SAM-modified electrodes in devices, a homogeneous mixing ...[more]

PMID: 27429041

Similar Datasets

Understanding Chemical versus Electrostatic Shifts in X-ray Photoelectron Spectra of Organic Self-Assembled Monolayers.

Project description:The focus of the present article is on understanding the insight that X-ray photoelectron spectroscopy (XPS) measurements can provide when studying self-assembled monolayers. Comparing density functional theory calculations to experimental data on deliberately chosen model systems, we show that both the chemical environment and electrostatic effects arising from a superposition of molecular dipoles influence the measured core-level binding energies to a significant degree. The crucial role of the often overlooked electrostatic effects in polar self-assembled monolayers (SAMs) is unambiguously demonstrated by changing the dipole density through varying the SAM coverage. As a consequence of this effect, care has to be taken when extracting chemical information from the XP spectra of ordered organic adsorbate layers. Our results, furthermore, imply that XPS is a powerful tool for probing local variations in the electrostatic energy in nanoscopic systems, especially in SAMs.

| S-EPMC4761973 | biostudies-literature

Comparisons of Analytical Approaches for Determining Shell Thicknesses of Core-Shell Nanoparticles by X-ray Photoelectron Spectroscopy.

Project description:We assessed two approaches for determining shell thicknesses of core-shell nanoparticles (NPs) by X-ray photoelectron spectroscopy (XPS). These assessments were based on simulations of photoelectron peak intensities for Au-core/C-shell, C-core/Au-shell, Cu-core/Al-shell, and Al-core/Cu-shell NPs with a wide range of core diameters and shell thicknesses. First, we demonstrated the validity of an empirical equation developed by Shard for determinations of shell thicknesses. Values of shell thicknesses from the Shard equation typically agreed with actual shell thicknesses to better than 10 %. Second, we investigated the magnitudes of elastic-scattering effects on photoelectron peak intensities by performing a similar series of simulations with elastic scattering switched off in our simulation software. Our ratios of the C-shell 1s intensity to the Au-core 4f7/2 intensity with elastic scattering switched off were qualitatively similar to those obtained by Torelli et al. from a model that neglected elastic scattering. With elastic scattering switched on, the C 1s/Au 4f7/2 intensity ratios generally changed by less than 10 %, thereby justifying the neglect of elastic scattering in XPS models that are applied to organic ligands on Au-core NPs. Nevertheless, elastic-scattering effects on peak-intensity ratios were generally much stronger for C-core/Au-shell, Al-core/Cu-shell, and Cu-core/Al-shell NPs, and there were second-order dependences on core diameter and shell thickness.

| S-EPMC5990282 | biostudies-literature

X-ray Photoelectron Spectroscopy (XPS) Depth Profiling for Evaluation of La₂Zr₂O₇ Buffer Layer Capacity.

Project description:Lanthanum zirconate (LZO) films from water-based precursors were deposited on Ni-5%W tape by chemical solution deposition. The buffer capacity of these layers includes the prevention of Ni oxidation of the substrate and Ni penetration towards the YBCO film which is detrimental for the superconducting properties. X-ray Photoelectron Spectroscopy depth profiling was used to study the barrier efficiency before and after an additional oxygen annealing step, which simulates the thermal treatment for YBCO thin film synthesis. Measurements revealed that the thermal treatment in presence of oxygen could severely increase Ni diffusion. Nonetheless it was shown that from the water-based precursors' buffer layers with sufficient barrier capacity towards Ni penetration could be synthesized if the layers meet a certain critical thickness and density.

| S-EPMC5448917 | biostudies-other

X-ray spectroscopy characterization of self-assembled monolayers of nitrile-substituted oligo(phenylene ethynylene)s with variable chain length.

Project description:Self-assembled monolayers (SAMs) of nitrile-substituted oligo(phenylene ethynylene) thiols (NC-OPEn) with a variable chain length n (n ranging from one to three structural units) on Au(111) were studied by synchrotron-based high-resolution X-ray photoelectron spectroscopy and near-edge absorption fine-structure spectroscopy. The experimental data suggest that the NC-OPEn molecules form well-defined SAMs on Au(111), with all the molecules bound to the substrate through the gold-thiolate anchor and the nitrile tail groups located at the SAM-ambient interface. The packing density in these SAMs was found to be close to that of alkanethiolate monolayers on Au(111), independent of the chain length. Similar behavior was found for the molecular inclination, with an average tilt angle of ~33-36° for all the target systems. In contrast, the average twist of the OPEn backbone (planar conformation) was found to depend on the molecular length, being close to 45° for the films comprising the short OPE chains and ~53.5° for the long chains. Analysis of the data suggests that the attachment of the nitrile moiety, which served as a spectroscopic marker group, to the OPEn backbone did not significantly affect the molecular orientation in the SAMs.

| S-EPMC3304316 | biostudies-literature

Correlating the Influence of Disulfides in Monolayers across Photoelectron Spectroscopy Wettability and Tunneling Charge-Transport.

Project description:Despite their ubiquity, self-assembled monolayers (SAMs) of thiols on coinage metals are difficult to study and are still not completely understood, particularly with respect to the nature of thiol-metal bonding. Recent advances in molecular electronics have highlighted this deficiency due to the sensitivity of tunneling charge-transport to the subtle differences in the overall composition of SAMs and the chemistry of their attachment to surfaces. These advances have also challenged assumptions about the spontaneous formation of covalent thiol-metal bonds. This paper describes a series of experiments that correlate changes in the physical properties of SAMs to photoelectron spectroscopy to unambiguously assign binding energies of noncovalent interactions to physisorbed disulfides. These disulfides can be converted to covalent metal-thiolate bonds by exposure to free thiols, leading to the remarkable observation of the total loss and recovery of length-dependent tunneling charge-transport. The identification and assignment of physisorbed disulfides solve a long-standing mystery and reveal new, dynamic properties in SAMs of thiols.

| S-EPMC7472521 | biostudies-literature

Following excited-state chemical shifts in molecular ultrafast x-ray photoelectron spectroscopy.

Project description:The conversion of photon energy into other energetic forms in molecules is accompanied by charge moving on ultrafast timescales. We directly observe the charge motion at a specific site in an electronically excited molecule using time-resolved x-ray photoelectron spectroscopy (TR-XPS). We extend the concept of static chemical shift from conventional XPS by the excited-state chemical shift (ESCS), which is connected to the charge in the framework of a potential model. This allows us to invert TR-XPS spectra to the dynamic charge at a specific atom. We demonstrate the power of TR-XPS by using sulphur 2p-core-electron-emission probing to study the UV-excited dynamics of 2-thiouracil. The method allows us to discover that a major part of the population relaxes to the molecular ground state within 220-250 fs. In addition, a 250-fs oscillation, visible in the kinetic energy of the TR-XPS, reveals a coherent exchange of population among electronic states.

| S-EPMC8752854 | biostudies-literature

X-ray photoelectron spectroscopy and infrared spectroscopy study of maleimide-activated supports for immobilization of oligodeoxyribonucleotides.

Project description:Surface-tethered nucleic acids are widely applied in solid-phase assays in which complementary strands must be detected against a complex mixture of other sequences. In response to such needs, numerous methods have been developed for immobilizing nucleic acids on solid supports. Often, detailed analysis of associated chemical transformations and of potential side reactions is difficult to obtain. Combined use of planar and high surface area powder supports allows characterization using surface as well as bulk diagnostic techniques. This approach is followed in the present study in which X-ray photoelectron spectroscopy (XPS), transmission infrared spectroscopy (FTIR) and reactivity titrations are used to investigate siliceous supports modified with an aminosilane precursor followed by a maleimide-bearing crosslinker for attachment of nucleic acids. The supports retain maleimide activity for approximately a day when stored under buffer, but deactivation is accelerated under basic conditions or by incomplete conversion of the precursor aminosilane monolayer. Reactions involving the olefinic bond of the imide as well as its carbonyl groups are observed and analyzed. Attachment of sulfhydryl-terminated oligodeoxyribonucleotides is highly site specific, and immobilized strands exhibit excellent hybridization activity. Quantitative use of XPS for label-free determination of DNA coverage based on calibration against reference materials is also described.

| S-EPMC534618 | biostudies-literature

Sensitive Marker of the Cisplatin-DNA Interaction: X-Ray Photoelectron Spectroscopy of CL.

Project description:The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20?hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells.

| S-EPMC3485869 | biostudies-literature

Gas Pulse-X-Ray Probe Ambient Pressure Photoelectron Spectroscopy with Submillisecond Time Resolution.

Project description:A setup capable of conducting gas pulse-X-ray probe ambient pressure photoelectron spectroscopy with high time resolution is presented. The setup makes use of a fast valve that creates gas pulses with an internal pressure in the mbar range and a rising edge of few hundreds of microseconds. A gated detector based on a fast camera is synchronized with the valve operation to measure X-ray photoemission spectra with up to 20 μs time resolution. The setup is characterized in several experiments in which the N2 gas is pulsed either into vacuum or a constant flow of another gas. The observed width of the pulse rising edge is 80 μs, and the maximum internal pulse pressure is ∼1 mbar. The CO oxidation reaction over Pt (111) was used to demonstrate the capability of the setup to correlate the gas phase composition with that of the surface during transient supply of CO gas into an O2 stream. Thus, formation of both chemisorbed and oxide oxygen species was observed prior to CO gas perturbation. Also, the data indicated that both the Langmuir-Hinshelwood and Mars-van-Krevelen mechanisms play an important role in the oxidation of carbon monoxide under ambient conditions.

| S-EPMC8517956 | biostudies-literature

Valence and Core-Level X-ray Photoelectron Spectroscopy of a Liquid Ammonia Microjet.

Project description:Photoelectron spectroscopy of microjets expanded into vacuum allows access to orbital energies for solute or solvent molecules in the liquid phase. Microjets of water, acetonitrile and alcohols have previously been studied; however, it has been unclear whether jets of low temperature molecular solvents could be realized. Here we demonstrate a stable 20 μm jet of liquid ammonia (-60 °C) in a vacuum, which we use to record both valence and core-level band photoelectron spectra using soft X-ray synchrotron radiation. Significant shifts from isolated ammonia in the gas-phase are observed, as is the liquid-phase photoelectron angular anisotropy. Comparisons with spectra of ammonia in clusters and the solid phase, as well as spectra for water in various phases potentially reveal how hydrogen bonding is reflected in the condensed phase electronic structure.

| S-EPMC6728086 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data