Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

X-ray Photoelectron Spectroscopy (XPS) Depth Profiling for Evaluation of La₂Zr₂O₇ Buffer Layer Capacity.

ABSTRACT: Lanthanum zirconate (LZO) films from water-based precursors were deposited on Ni-5%W tape by chemical solution deposition. The buffer capacity of these layers includes the prevention of Ni oxidation of the substrate and Ni penetration towards the YBCO film which is detrimental for the superconducting properties. X-ray Photoelectron Spectroscopy depth profiling was used to study the barrier efficiency before and after an additional oxygen annealing step, which simulates the thermal treatment for YBCO thin film synthesis. Measurements revealed that the thermal treatment in presence of oxygen could severely increase Ni diffusion. Nonetheless it was shown that from the water-based precursors' buffer layers with sufficient barrier capacity towards Ni penetration could be synthesized if the layers meet a certain critical thickness and density.

SUBMITTER: Narayanan V

PROVIDER: S-EPMC5448917 | biostudies-other | 2012 Feb

REPOSITORIES: biostudies-other

ACCESS DATA

Json Xml

Similar Datasets

Depth-profiling X-ray photoelectron spectroscopy (XPS) analysis of interlayer diffusion in polyelectrolyte multilayers.

Project description:Functional organic thin films often demand precise control over the nanometer-level structure. Interlayer diffusion of materials may destroy this precise structure; therefore, a better understanding of when interlayer diffusion occurs and how to control it is needed. X-ray photoelectron spectroscopy paired with C60(+) cluster ion sputtering enables high-resolution analysis of the atomic composition and chemical state of organic thin films with depth. Using this technique, we explore issues common to the polyelectrolyte multilayer field, such as the competition between hydrogen bonding and electrostatic interactions in multilayers, blocking interlayer diffusion of polymers, the exchange of film components with a surrounding solution, and the extent and kinetics of interlayer diffusion. The diffusion coefficient of chitosan (M = ?100 kDa) in swollen hydrogen-bonded poly(ethylene oxide)/poly(acrylic acid) multilayer films was examined and determined to be 1.4*10(-12) cm(2)/s. Using the high-resolution data, we show that upon chitosan diffusion into the hydrogen-bonded region, poly(ethylene oxide) is displaced from the film. Under the conditions tested, a single layer of poly(allylamine hydrochloride) completely stops chitosan diffusion. We expect our results to enhance the understanding of how to control polyelectrolyte multilayer structure, what chemical compositional changes occur with diffusion, and under what conditions polymers in the film exchange with the solution.

| S-EPMC3637782 | biostudies-literature

Employing X-ray Photoelectron Spectroscopy for Determining Layer Homogeneity in Mixed Polar Self-Assembled Monolayers.

Project description:Self-assembled monolayers (SAMs) containing embedded dipolar groups offer the particular advantage of changing the electronic properties of a surface without affecting the SAM-ambient interface. Here we show that such systems can also be used for continuously tuning metal work functions by growing mixed monolayers consisting of molecules with different orientations of the embedded dipolar groups. To avoid injection hot-spots when using the SAM-modified electrodes in devices, a homogeneous mixing of the two components is crucial. We show that a combination of high-resolution X-ray photoelectron spectroscopy with state-of-the-art simulations is an ideal tool for probing the electrostatic homogeneity of the layers and thus for determining phase separation processes in polar adsorbate assemblies down to inhomogeneities at the molecular level.

| S-EPMC4976398 | biostudies-literature

X-ray Photoelectron Spectroscopy (XPS) Analysis of Nitrogen Environment in Small Extracellular Vesicle Membranes: A Potential Novel Technique with Application for Cancer Screening.

Project description:Small extracellular vesicle (EV) membranes display characteristic protein-lipidic composition features that are related to their cell of origin, providing valuable clues regarding their parental cell composition and real-time state. This could be especially interesting in the case of cancer cell-derived EVs, as their membranes could serve as valuable tools in liquid biopsy applications and to detect changes in the tumor malignancy. X-Ray Photoelectron Spectroscopy (XPS) is a powerful surface analysis technique able to detect every chemical element present, being also sensitive to their chemical environment. Here we explore the use of XPS as a fast technique to characterize EV membrane composition, with possible application in cancer research. Notably, we have focused on the nitrogen environment as an indicator of the relative abundance of pyridine-type bonding, primary, secondary and tertiary amines. Specifically, we have analyzed how tumoral and healthy cells have different nitrogen chemical environments that can indicate the presence or absence of malignancy. In addition, a collection of human serum samples from cancer patients and healthy donors was also analyzed. The differential XPS analysis of EVs collected from patients confirmed that the patterns of amine evolution could be related to markers of cancer disease, opening the possibility of their use as a non-invasive blood biomarker.

| S-EPMC10177571 | biostudies-literature

Relating X-ray photoelectron spectroscopy data to chemical bonding in MXenes.

Project description:The relationship between core level binding energy shifts (ΔCLBEs), that can be experimentally determined by X-ray photoelectron spectroscopy, and chemical bonding is analyzed for a series of MXenes, a new family of two-dimensional materials with a broad number of applications in nanotechnology. Based on first-principles calculations, the atomic and electronic structure of bare and O-terminated carbide MXene with M2C and M2CO2 (M = Ti, Zr, Hf, V, Nb, Ta, Cr, Mo, and W) stoichiometries are investigated with a focus on trends in the C(1s) and O(1s) ΔCLBEs, including initial and final state effects, along with the series. A rather good linear correlation between the available experimental and calculated C(1s) and O(1s) ΔCLBEs exists, with quantitative agreement when final state effects are included, that validates the conclusions from the present computational approach. The present study shows that ΔCLBEs of bare MXenes are governed by the initial state effects and directly correlate with the net charge on the C atoms. However, for the case of O-terminated MXenes, C(1s) and O(1s) ΔCLBEs exhibit a much less significant correlation with the net charge of either C or O atoms which is attributed to the structural changes induced on the M2C moiety by the presence of the O layers and the different stacking sequence observed depending on the MXene composition. The present study shows how and when XPS can be used to extract information regarding the nature of the chemical bond in bare or functionalized MXenes.

| S-EPMC9418319 | biostudies-literature

Following excited-state chemical shifts in molecular ultrafast x-ray photoelectron spectroscopy.

Project description:The conversion of photon energy into other energetic forms in molecules is accompanied by charge moving on ultrafast timescales. We directly observe the charge motion at a specific site in an electronically excited molecule using time-resolved x-ray photoelectron spectroscopy (TR-XPS). We extend the concept of static chemical shift from conventional XPS by the excited-state chemical shift (ESCS), which is connected to the charge in the framework of a potential model. This allows us to invert TR-XPS spectra to the dynamic charge at a specific atom. We demonstrate the power of TR-XPS by using sulphur 2p-core-electron-emission probing to study the UV-excited dynamics of 2-thiouracil. The method allows us to discover that a major part of the population relaxes to the molecular ground state within 220-250 fs. In addition, a 250-fs oscillation, visible in the kinetic energy of the TR-XPS, reveals a coherent exchange of population among electronic states.

| S-EPMC8752854 | biostudies-literature

Single-Layer Graphene/Germanium Interface Representing a Schottky Junction Studied by Photoelectron Spectroscopy.

Project description:We investigated the interfacial electronic structure of the bidimensional interface of single-layer graphene on a germanium substrate. The procedure followed a well-established approach using ultraviolet (UPS) and X-ray (XPS) photoelectron spectroscopy. The direct synthesis of the single-layer graphene on the surface of (110) undoped Ge substrates was conducted via chemical vapor deposition (CVD). The main graphitic properties of the systems were identified, and it was shown that the Ge substrate affected the electronic structure of the single-layer graphene, indicating the electronic coupling between the graphene and the Ge substrate. Furthermore, the relevant features associated with the Schottky contact's nature, the energy level's alignments, and the energy barrier's heights for electron and hole injection were obtained in this work. The results are useful, given the possible integration of single-layer graphene on a Ge substrate with the complementary metal-oxide-semiconductor (CMOS) technology.

| S-EPMC10420948 | biostudies-literature

X-ray photoelectron spectroscopy and infrared spectroscopy study of maleimide-activated supports for immobilization of oligodeoxyribonucleotides.

Project description:Surface-tethered nucleic acids are widely applied in solid-phase assays in which complementary strands must be detected against a complex mixture of other sequences. In response to such needs, numerous methods have been developed for immobilizing nucleic acids on solid supports. Often, detailed analysis of associated chemical transformations and of potential side reactions is difficult to obtain. Combined use of planar and high surface area powder supports allows characterization using surface as well as bulk diagnostic techniques. This approach is followed in the present study in which X-ray photoelectron spectroscopy (XPS), transmission infrared spectroscopy (FTIR) and reactivity titrations are used to investigate siliceous supports modified with an aminosilane precursor followed by a maleimide-bearing crosslinker for attachment of nucleic acids. The supports retain maleimide activity for approximately a day when stored under buffer, but deactivation is accelerated under basic conditions or by incomplete conversion of the precursor aminosilane monolayer. Reactions involving the olefinic bond of the imide as well as its carbonyl groups are observed and analyzed. Attachment of sulfhydryl-terminated oligodeoxyribonucleotides is highly site specific, and immobilized strands exhibit excellent hybridization activity. Quantitative use of XPS for label-free determination of DNA coverage based on calibration against reference materials is also described.

| S-EPMC534618 | biostudies-literature

Gas Pulse-X-Ray Probe Ambient Pressure Photoelectron Spectroscopy with Submillisecond Time Resolution.

Project description:A setup capable of conducting gas pulse-X-ray probe ambient pressure photoelectron spectroscopy with high time resolution is presented. The setup makes use of a fast valve that creates gas pulses with an internal pressure in the mbar range and a rising edge of few hundreds of microseconds. A gated detector based on a fast camera is synchronized with the valve operation to measure X-ray photoemission spectra with up to 20 μs time resolution. The setup is characterized in several experiments in which the N2 gas is pulsed either into vacuum or a constant flow of another gas. The observed width of the pulse rising edge is 80 μs, and the maximum internal pulse pressure is ∼1 mbar. The CO oxidation reaction over Pt (111) was used to demonstrate the capability of the setup to correlate the gas phase composition with that of the surface during transient supply of CO gas into an O2 stream. Thus, formation of both chemisorbed and oxide oxygen species was observed prior to CO gas perturbation. Also, the data indicated that both the Langmuir-Hinshelwood and Mars-van-Krevelen mechanisms play an important role in the oxidation of carbon monoxide under ambient conditions.

| S-EPMC8517956 | biostudies-literature

Valence and Core-Level X-ray Photoelectron Spectroscopy of a Liquid Ammonia Microjet.

Project description:Photoelectron spectroscopy of microjets expanded into vacuum allows access to orbital energies for solute or solvent molecules in the liquid phase. Microjets of water, acetonitrile and alcohols have previously been studied; however, it has been unclear whether jets of low temperature molecular solvents could be realized. Here we demonstrate a stable 20 μm jet of liquid ammonia (-60 °C) in a vacuum, which we use to record both valence and core-level band photoelectron spectra using soft X-ray synchrotron radiation. Significant shifts from isolated ammonia in the gas-phase are observed, as is the liquid-phase photoelectron angular anisotropy. Comparisons with spectra of ammonia in clusters and the solid phase, as well as spectra for water in various phases potentially reveal how hydrogen bonding is reflected in the condensed phase electronic structure.

| S-EPMC6728086 | biostudies-literature

Sensitive Marker of the Cisplatin-DNA Interaction: X-Ray Photoelectron Spectroscopy of CL.

Project description:The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20 hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells.

| S-EPMC3485869 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data