Dataset Information

Vascular smooth muscle cell contractile protein expression is increased through protein kinase G-dependent and -independent pathways by glucose-6-phosphate dehydrogenase inhibition and deficiency.

ABSTRACT: Homeostatic control of vascular smooth muscle cell (VSMC) differentiation is critical for contractile activity and regulation of blood flow. Recently, we reported that precontracted blood vessels are relaxed and the phenotype of VSMC is regulated from a synthetic to contractile state by glucose-6-phosphate dehydrogenase (G6PD) inhibition. In the current study, we investigated whether the increase in the expression of VSMC contractile proteins by inhibition and knockdown of G6PD is mediated through a protein kinase G (PKG)-dependent pathway and whether it regulates blood pressure. We found that the expression of VSMC-restricted contractile proteins, myocardin (MYOCD), and miR-1 and miR-143 are increased by G6PD inhibition or knockdown. Importantly, RNA-sequence analysis of aortic tissue from G6PD-deficient mice revealed uniform increases in VSMC-restricted genes, particularly those regulated by the MYOCD-serum response factor (SRF) switch. Conversely, expression of Krüppel-like factor 4 (KLF4) is decreased by G6PD inhibition. Interestingly, the G6PD inhibition-induced expression of miR-1 and contractile proteins was blocked by Rp-?-phenyl-1,N2-etheno-8-bromo-guanosine-3',5'-cyclic monophosphorothioate, a PKG inhibitor. On the other hand, MYOCD and miR-143 levels are increased by G6PD inhibition through a PKG-independent manner. Furthermore, blood pressure was lower in the G6PD-deficient compared with wild-type mice. Therefore, our results suggest that the expression of VSMC contractile proteins induced by G6PD inhibition occurs via PKG1?-dependent and -independent pathways.

SUBMITTER: Chettimada S

PROVIDER: S-EPMC5114469 | biostudies-literature | 2016 Oct

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Vascular smooth muscle cell contractile protein expression is increased through protein kinase G-dependent and -independent pathways by glucose-6-phosphate dehydrogenase inhibition and deficiency.

Chettimada Sukrutha S Joshi Sachindra Raj SR Dhagia Vidhi V Aiezza Alessandro A Lincoln Thomas M TM Gupte Rakhee R Miano Joseph M JM Gupte Sachin A SA

American journal of physiology. Heart and circulatory physiology 20160812 4

Homeostatic control of vascular smooth muscle cell (VSMC) differentiation is critical for contractile activity and regulation of blood flow. Recently, we reported that precontracted blood vessels are relaxed and the phenotype of VSMC is regulated from a synthetic to contractile state by glucose-6-phosphate dehydrogenase (G6PD) inhibition. In the current study, we investigated whether the increase in the expression of VSMC contractile proteins by inhibition and knockdown of G6PD is mediated throu ...[more]

PMID: 27521420

Similar Datasets

Project description:Purpose: Homeostatic control of vascular smooth muscle cell (VSMC) differentiation is critical for contractile activity and regulation of blood flow. Recently, we reported that pre-contracted blood vessels are relaxed and the phenotype of VSMC is regulated from a synthetic to contractile state by glucose-6-phosphate dehydrogenase (G6PD) inhibition. In the current study, we investigated whether the increase in the expression of VSMC contractile proteins by inhibition and knockdown of G6PD is mediated through a protein kinase G (PKG)-dependent pathway and whether it regulates blood pressure Methods: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500. The sequence reads that passed quality filters (Trimmomatic-0.32) were analyzed at the transcript isoform level using STAR_2.4.2a for mapping to reference GRCm38.p4 + Gencode-M6 Annotation and processed with Cufflinks-2.0.2. miR analysis was performed by quantitative RT-PCR (qRT-PCR) for validation using miR-specific TaqMan miR assays (Applied Biosystems, Foster City, CA). Quantitative PCR was performed in triplicate using TaqMan Universal PCR Master mix. Standard curves were made for each miR using synthetic miR oligonucleotides (IDT, Coralville, IA) with the following sequence: Rno-miR-145: GUCCAGUUUUCCCAGGAAUCCCU, Rno-miR-1: UGGAAUGUAAAGAAGUGUGUAU, Rno-miR-143: UGAGAUGAAGCACUGUAGCUC, Rno-miR-133a: UUUGGUCCCCUUCAACCAGCUG Results: We found that the expression of VSMC-restricted contractile proteins, myocardin (MYOCD), and miR-1 and miR-143 are increased by G6PD inhibition or knockdown. Importantly, RNA-sequence analysis of aortic tissue from G6PD-deficient mice revealed uniform increases in VSMC-restricted genes, particularly those regulated by the MYOCD-serum response factor (SRF) switch. Conversely, expression of Krüppel-like factor 4 (KLF4) is decreased by G6PD inhibition. Interestingly, the G6PD inhibition-induced expression of miR-1 and contractile proteins was blocked by Rp-β-phenyl-1,N2-etheno-8-bromo-guanosine-3’,5’-cyclic monophosphorothioate, a PKG inhibitor. On the other hand, MYOCD and miR-143 levels are increased by G6PD inhibition through a PKG-independent manner. Furthermore, blood pressure was lower in the G6PD-deficient as compared to wild-type mice Conclusions: Therefore, our results suggest that the expression of VSMC contractile proteins induced by G6PD inhibition occurs via PKG1-dependent and –independent pathways

Project description:Glucose-6-phosphate dehydrogenase (G6PD) is the rate-limiting enzyme in the pentose phosphate pathway and a major source of nicotinamide adenine dinucleotide phosphate reduced (NADPH), which regulates numerous enzymatic (including glutathione reductase and NADPH oxidase that, respectively, generates reduced glutathione and reactive oxygen species) reactions involved in various cellular actions, yet its physiological function is seldom investigated. We, however, recently showed that inhibiting G6PD causes precontracted coronary artery (CA) to relax in an endothelium-derived relaxing factor- and second messenger-independent manner. Here we assessed the role of G6PD in regulating CA contractility. Treating bovine CAs for 20 min with potassium chloride (KCl; 30 mM), amphotericin B (50 ?M), or U46619 (100 nM) significantly (p < 0.05) increased both G6PD activity and glucose flux through the pentose phosphate pathway. The effect was Ca(2+) independent, and there was a corresponding increase in protein kinase C (PKC) activity. Activation of G6PD by KCl was blocked by the PKC? inhibitor rottlerin (10 ?M) or by knocking down PKC? expression using siRNA. Phorbol 12, 13-dibutyrate (10 ?M), a PKC activator, significantly increased G6PD phosphorylation and activity, whereas single (S210A, T266A) and double (S210A/T266A) mutations at sites flanking the G6PD active site significantly inhibited phosphorylation, shifted the isoelectric point, and reduced enzyme activity. Knocking down G6PD decreased NADPH and reactive oxygen species generation, and reduced KCl-evoked increases in [Ca(2+)](i) and myosin light chain phosphorylation, thereby reducing CA contractility. Similarly, aortas from G6PD-deficient mice developed less KCl/phorbol 12, 13-dibutyrate-evoked force than those from their wild-type littermates. Conversely, overexpression of G6PD augmented KCl-evoked increases in [Ca(2+)](i), thereby augmenting CA contraction. Our findings demonstrate that G6PD activity and NADPH is increased in activated CA in a PKC?-dependent manner and that G6PD modulates Ca(2+) entry and CA contractions evoked by membrane depolarization.

Project description:BACKGROUNDGlucose-6-phosphate dehydrogenase (G6PD) deficiency decreases the ability of red blood cells (RBCs) to withstand oxidative stress. Refrigerated storage of RBCs induces oxidative stress. We hypothesized that G6PD-deficient donor RBCs would have inferior storage quality for transfusion as compared with G6PD-normal RBCs.METHODSMale volunteers were screened for G6PD deficiency; 27 control and 10 G6PD-deficient volunteers each donated 1 RBC unit. After 42 days of refrigerated storage, autologous 51-chromium 24-hour posttransfusion RBC recovery (PTR) studies were performed. Metabolomics analyses of these RBC units were also performed.RESULTSThe mean 24-hour PTR for G6PD-deficient subjects was 78.5% ± 8.4% (mean ± SD), which was significantly lower than that for G6PD-normal RBCs (85.3% ± 3.2%; P = 0.0009). None of the G6PD-normal volunteers (0/27) and 3 G6PD-deficient volunteers (3/10) had PTR results below 75%, a key FDA acceptability criterion for stored donor RBCs. As expected, fresh G6PD-deficient RBCs demonstrated defects in the oxidative phase of the pentose phosphate pathway. During refrigerated storage, G6PD-deficient RBCs demonstrated increased glycolysis, impaired glutathione homeostasis, and increased purine oxidation, as compared with G6PD-normal RBCs. In addition, there were significant correlations between PTR and specific metabolites in these pathways.CONCLUSIONBased on current FDA criteria, RBCs from G6PD-deficient donors would not meet the requirements for storage quality. Metabolomics assessment identified markers of PTR and G6PD deficiency (e.g., pyruvate/lactate ratios), along with potential compensatory pathways that could be leveraged to ameliorate the metabolic needs of G6PD-deficient RBCs.TRIAL REGISTRATIONClinicalTrials.gov NCT04081272.FUNDINGThe Harold Amos Medical Faculty Development Program, Robert Wood Johnson Foundation grant 71590, the National Blood Foundation, NIH grant UL1 TR000040, the Webb-Waring Early Career Award 2017 by the Boettcher Foundation, and National Heart, Lung, and Blood Institute grants R01HL14644 and R01HL148151.

Dataset Information

Vascular smooth muscle cell contractile protein expression is increased through protein kinase G-dependent and -independent pathways by glucose-6-phosphate dehydrogenase inhibition and deficiency.

Publications

Vascular smooth muscle cell contractile protein expression is increased through protein kinase G-dependent and -independent pathways by glucose-6-phosphate dehydrogenase inhibition and deficiency.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets