Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Bisguanidinium dinuclear oxodiperoxomolybdosulfate ion pair-catalyzed enantioselective sulfoxidation.

ABSTRACT: Catalytic use of peroxomolybdate for asymmetric transformations has attracted increasing attention due to its catalytic properties and application in catalysis. Herein, we report chiral bisguanidinium dinuclear oxodiperoxomolybdosulfate [BG]2+[(?-SO4)Mo2O2(?-O2)2(O2)2]2- ion pair, as a catalyst for enantioselective sulfoxidation using aqueous H2O2 as the terminal oxidant. The ion pair catalyst is isolatable, stable and useful for the oxidation of a range of dialkyl sulfides. The practical utility was illustrated using a gram-scale synthesis of armodafinil, a commercial drug, with the catalyst generated in situ from 0.25?mol% of bisguanidinium and 2.5?mol% of Na2MoO4·2H2O. Structural characterization of this ion pair catalyst has been successfully achieved using single-crystal X-ray crystallography.

SUBMITTER: Zong L

PROVIDER: S-EPMC5121337 | biostudies-literature | 2016 Nov

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Bisguanidinium dinuclear oxodiperoxomolybdosulfate ion pair-catalyzed enantioselective sulfoxidation.

Zong Lili L Wang Chao C Moeljadi Adhitya Mangala Putra AM Ye Xinyi X Ganguly Rakesh R Li Yongxin Y Hirao Hajime H Tan Choon-Hong CH

Nature communications 20161121

Catalytic use of peroxomolybdate for asymmetric transformations has attracted increasing attention due to its catalytic properties and application in catalysis. Herein, we report chiral bisguanidinium dinuclear oxodiperoxomolybdosulfate [BG]2+[(μ-SO4)Mo2O2(μ-O2)2(O2)2]2- ion pair, as a catalyst for enantioselective sulfoxidation using aqueous H2O2 as the terminal oxidant. The ...[more]

PMID: 27869124

Similar Datasets

Dinuclear zinc-ProPhenol-catalyzed enantioselective α-hydroxyacetate aldol reaction with activated ester equivalents.

Project description:An enantioselective α-hydroxyacetate aldol reaction that employs N-acetyl pyrroles as activated ester equivalents and generates syn 1,2-diols in good yield and diastereoselectivity is reported. This dinuclear zinc-ProPhenol-catalyzed transformation proceeds with high enantioselectivity with a wide variety of substrates including aryl, alyl, and alkenyl aldehydes. The resulting α,β-dihydroxy activated esters are versatile intermediates for the synthesis of a variety of carboxylic acid derivatives including amides, esters, and unsymmetrical ketones.

| S-EPMC3812954 | biostudies-literature

Controlling Regioselectivity in the Enantioselective N-Alkylation of Indole Analogues Catalyzed by Dinuclear Zinc-ProPhenol.

Project description:The enantioselective N-alkylation of indole and its derivatives with aldimines is efficiently catalyzed by a zinc-ProPhenol dinuclear complex under mild conditions to afford N-alkylated indole derivatives in good yield (up to 86?%) and excellent enantiomeric ratio (up to 99.5:0.5 e.r.). This method tolerates a wide array of indoles, as well as pyrrole and carbazole, to afford the corresponding N-alkylation products. The reaction can be run on a gram scale with reduced catalyst loading without impacting the efficiency. The chiral aminals were further elaborated into various chiral polyheterocyclic derivatives. The surprising stability of the chiral N-alkylation products will open new windows for asymmetric catalysis and medicinal chemistry.

| S-EPMC5706662 | biostudies-literature

Molybdenum-Catalyzed Enantioselective Sulfoxidation Controlled by a Nonclassical Hydrogen Bond between Coordinated Chiral Imidazolium-Based Dicarboxylate and Peroxido Ligands.

Project description:Chiral alkyl aryl sulfoxides were obtained by molybdenum-catalyzed oxidation of alkyl aryl sulfides with hydrogen peroxide as oxidant in mild conditions with high yields and moderate enantioselectivities. The asymmetry is generated by the use of imidazolium-based dicarboxylic compounds, HLR. The in-situ-generated catalyst, a mixture of aqueous [Mo(O)(O₂)₂(H₂O)n] with HLR as chirality inductors, in the presence of [PPh₄]Br, was identified as the anionic binuclear complex [PPh₄]{[Mo(O)(O₂)₂(H₂O)]₂(μ-LR)}, according to spectroscopic data and Density Functional Theory (DFT) calculations. A nonclassical hydrogen bond between one C⁻H bond of the alkyl R group of coordinated (LR)− and one oxygen atom of the peroxido ligand was identified as the interaction responsible for the asymmetry in the process. Additionally, the step that governs the enantioselectivity was theoretically analyzed by locating the transition states of the oxido-transfer to PhMeS of model complexes [Mo(O)(O₂)₂(H₂O)(κ¹-O-LR)]− (R = H, iPr). The ∆∆G≠ is ca. 0 kcal∙mol−1 for R = H, racemic sulfoxide, meanwhile for chiral species the ∆∆G≠ of ca. 2 kcal∙mol−1 favors the formation of (R)-sulfoxide.

| S-EPMC6100257 | biostudies-literature

Enantioselective sulfoxidation using Streptomyces glaucescens GLA.0.

Project description:Asymmetric oxidation of prochiral sulfides is a direct means for production of enantiopure sulfoxides which are important in organic synthesis and the pharmaceutical industry. In the present study, Streptomyces glaucescens GLA.0 was employed for stereoselective oxidation of prochiral sulfides. Growing cells selectively catalyzed the oxidation of phenyl methyl sulfide to the corresponding sulfoxide. Only very little overoxidation was observed, resulting in minor amounts of the unwanted sulfone. Addition of isopropyl alcohol as a co-solvent, time of substrate addition and composition of the reaction media resulted in enhanced phenyl methyl sulfide biotransformation. The concentration of the undesired by-product (sulfone) was as low as 4% through the reaction course under optimal reaction conditions. The results show that S. glaucescens GLA.0 is a promising whole-cell biocatalyst for preparing highly enantiopure (R)-phenyl methyl sulfoxide in high yield (90%) with an enantiomeric excess (ee) exceeding 99%.

| S-EPMC9056634 | biostudies-literature

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction.

Project description:The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or β-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.

| S-EPMC8835054 | biostudies-literature

Elucidating Sulfide Activation Mode in Metal-Catalyzed Sulfoxidation Reactivity.

Project description:Interest in the catalytic activation of peroxides, together with the requirement of stereoselectivity for the production of enantiopure sulfoxides, has made sulfoxidation the ideal playground for theoretical and experimental physical organic chemists investigating oxidation reactivity. Efforts have been dedicated for elucidating the catalytic pathway regarding these species and for dissecting out the dominant factors influencing the yield and stereochemistry. In this article, Ti(IV) and Hf(IV) aminotriphenolate complexes have been prepared and investigated as catalysts in the presence of peroxides in sulfide oxidation. Experimental results have been combined with theoretical calculations obtaining detailed mechanistic information on oxygen transfer processes. The study revealed that steric issues are mainly responsible for the formation of intermediates in the oxidation pathway. In particular, we could highlight the occurrence of a blended situation where the steric effects of sulfides, ligands, and oxidants influence the formation of different intermediates and reaction pathways.

| S-EPMC8924929 | biostudies-literature

Chiral ion-pair organocatalyst promotes highly enantioselective 3-exo iodo-cycloetherification of allyl alcohols.

Project description:By designing a novel chiral ion-pair organocatalyst composed of chiral phosphate and DABCO-derived quaternary ammonium, highly enantioselective 3-exo iodo-cycloetherification of allyl alcohols was achieved using NIS as a halogen source. Based on this reaction, one-pot asymmetric 3-exo iodo-cycloetherification/Wagner-Meerwein rearrangement of allyl alcohols en route to enantioenriched 2-iodomethyl-2-aryl cycloalkanones was subsequently developed. Due to the participation of adjacent iodine, the Wagner-Meerwein rearrangement of 2-iodomethyl-2-aryl epoxide proceeds with unusual retention of stereoconfiguration.

| S-EPMC5947518 | biostudies-literature

Ferrocenyl chiral bisphosphorus ligands for highly enantioselective asymmetric hydrogenation via noncovalent ion pair interaction.

Project description:A new class of ferrocenyl chiral bisphosphorus ligand, Wudaphos, was developed, and exhibits excellent ee and activity (ee up to 99%, TON up to 20?000) for the asymmetric hydrogenation of both 2-aryl and 2-alkyl acrylic acids through ion pair noncovalent interaction under base free and mild reaction conditions. Well-known anti-inflammatory drugs such as naproxen and ibuprofen together with the intermediate for the preparation of Roche ester and some bioactive compounds were also efficiently obtained with excellent ee. Control experiments were conducted and revealed that the ion pair noncovalent interaction and chain length played important roles.

| S-EPMC5450526 | biostudies-literature

Dinuclear Zn-catalyzed asymmetric alkynylation of unsaturated aldehydes.

Project description:Our recent development of a proline-derived bimetallic catalyst has led to a number of efficient, catalytic, enantioselective transformations. Herein, we report a practical and general alkynylation of aromatic and alpha,beta-unsaturated aldehydes using our zinc catalyst system.

| S-EPMC2596613 | biostudies-literature

Nucleobase Pair-Metal Dimer/Dinuclear Metal Cation Interaction: A Theoretical Study.

Project description:Nucleobase pair-metal dimer/dinuclear metal cation interactions play an important role in biological applications because of their highly symmetrical structures and high stabilities. In this work, we have selected five adenine-adenine hydrogen bonding, adenine-thymine (AT), adenine-uracil, adenine-adenine stacking pairs, and Watson-Crick AT stacking pairs and studied their interaction with the coinage metal dimer M2 and M2 2+ metal cations, where M = Ag, Au, and Cu. Quantum chemical calculations have been carried out with density functional theory (DFT) and time-dependent DFT (TDDFT) methods. Electronic structures were analyzed by the partial density of states method. During interactions, we find that M-M distances are shorter than the sum of van der Waals radii of the corresponding two homocoinage metal atoms, which show the existence of significant metallophilic interactions. Results indicated that nucleobase-M2 2+ complexes are stronger as compared to nucleobase-M2 complexes. Also, the replacement of the hydrogen bond by the dinuclear metal cation-coordinated bond forms more stable alternative metallo-DNA sequences in AAST base pairs. TDDFT calculations reveal that nucleobase-Cu2 complexes and nucleobase-Ag2 2+/Au2 2+ complexes can be used for fluorescent markers and logic gate applications. Atom-in-molecules analysis predicted the noncovalent interaction in these complexes.

| S-EPMC7408194 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data