Enantioselective sulfoxidation using Streptomyces glaucescens GLA.0.
Ontology highlight
ABSTRACT: Asymmetric oxidation of prochiral sulfides is a direct means for production of enantiopure sulfoxides which are important in organic synthesis and the pharmaceutical industry. In the present study, Streptomyces glaucescens GLA.0 was employed for stereoselective oxidation of prochiral sulfides. Growing cells selectively catalyzed the oxidation of phenyl methyl sulfide to the corresponding sulfoxide. Only very little overoxidation was observed, resulting in minor amounts of the unwanted sulfone. Addition of isopropyl alcohol as a co-solvent, time of substrate addition and composition of the reaction media resulted in enhanced phenyl methyl sulfide biotransformation. The concentration of the undesired by-product (sulfone) was as low as 4% through the reaction course under optimal reaction conditions. The results show that S. glaucescens GLA.0 is a promising whole-cell biocatalyst for preparing highly enantiopure (R)-phenyl methyl sulfoxide in high yield (90%) with an enantiomeric excess (ee) exceeding 99%.
Project description:Catalytic use of peroxomolybdate for asymmetric transformations has attracted increasing attention due to its catalytic properties and application in catalysis. Herein, we report chiral bisguanidinium dinuclear oxodiperoxomolybdosulfate [BG]2+[(?-SO4)Mo2O2(?-O2)2(O2)2]2- ion pair, as a catalyst for enantioselective sulfoxidation using aqueous H2O2 as the terminal oxidant. The ion pair catalyst is isolatable, stable and useful for the oxidation of a range of dialkyl sulfides. The practical utility was illustrated using a gram-scale synthesis of armodafinil, a commercial drug, with the catalyst generated in situ from 0.25?mol% of bisguanidinium and 2.5?mol% of Na2MoO4·2H2O. Structural characterization of this ion pair catalyst has been successfully achieved using single-crystal X-ray crystallography.
Project description:The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or β-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.
Project description:Site-directed mutagenesis was used to determine the functional role of several residues of Streptomyces glaucescens tyrosinase. Replacement of His-37, -53, -193 or -215 by glutamine yields albino phenotypes, as determined by expression on melanin-indicator plates. The purified mutant proteins display no detectable oxy-enzyme and increased Cu lability at the binuclear active site. The carbonyl derivatives of H189Q and H193Q luminesce, with lambda max. displaced more than 25 nm to a longer wavelength compared with native tyrosinase. The remaining histidine mutants display no detectable luminescence. The results are consistent with these histidine residues (together with His-62 and His-189 reported earlier) acting as Cu ligands in the Streptomyces glaucescens enzyme. Conservative substitution of the invariant Asn-190 by glutamine also gives an albino phenotype, no detectable oxy-enzyme and labilization of active-site Cu. The luminescence spectrum of carbonyl-N190Q, however, closely resembles that of the native enzyme under conditions promoting double Cu occupancy of the catalytic site. A critical role for Asn-190 in active-site hydrogen-bonding interactions is proposed.
Project description:The Streptomyces glaucescens genome frequently undergoes gross genomic rearrangement events which result in the deletion of extremely large segments of chromosomal DNA. The structure and origin of the DNA forming the novel junctions arising from five of these deletion events are described. Only one junction proved to be the result of a relatively simple event; the remainder were more complex, with one involving DNA which originated from at least five distinct loci. In three of the investigated cases, DNA sequences present in the junctions appeared to have resulted from the duplication of previously unique sequences, suggesting that duplication of chromosomal segments may be an important factor in genetic instability. The nucleotide sequences surrounding these junctions and their respective wild-type termini were determined.
Project description:In this study, synthetic allomelanin was prepared from wild-type Streptomyces glaucescens and recombinant Escherichia coli BL21(DE3) strains. S. glaucescens could produce 125.25 ± 6.01 mg/L of melanin with a supply of 5 mM caffeic acid within 144 h. The ABTS radical scavenging capacity of S. glaucescens melanin was determined to be approximately 7.89 mg/mL of IC50 value, which was comparable to L-tyrosine-based eumelanin. The isolated melanin was used in cotton fabric dyeing, and the effect of copper ions, laccase enzyme treatment, and the dyeing cycle on dyeing performance was investigated. Interestingly, dyeing fastness was greatly improved upon treatment with the laccase enzyme during the cotton dyeing process. Besides, the supply of C5-diamine, which was reported to lead to more complex crosslinking between melanin units, to caffeic acid-based melanin synthesis was also investigated for higher production and novel functionalities. To facilitate the supply of caffeic acid and C5-diamine, E. coli strains expressing each or combinations of tyrosine ammonia lyase/p-coumarate 3-hydroxylase, feruloyl-CoA synthetase/enoyl-CoA hydratase/aldolase, and tyrosinase/lysine decarboxylase enzymes were prepared and investigated for their eumelanin, C5-diamine, and allomelanin production from L-tyrosine and L-lysine, respectively. Finally, H-NMR, FT-IR, and MALDI-TOF analysis of the synthetic melanin pigments were attempted to obtain the chemical information.
Project description:Streptomyces glaucescens has a DNAase whose synthesis is under nutritional control. We have purified this enzyme to apparent homogeneity by phosphocellulose chromatography followed by heparin-agarose, Cibacron Blue F3-GA-Sepharose and Sephadex G-75 chromatography and MonoQ f.p.l.c. The enzyme had an apparent Mr of 39,600 and a pI of approx. 8.15. The Mr of the native enzyme estimated by gel chromatography was 49,000. The DNAase had a pH optimum of 7.5 and an absolute requirement for bivalent cations in the reaction buffer. It was inhibited by high salt concentrations, chelating agents or phosphate-containing compounds and was stimulated by dimethyl sulphoxide. The activity was greatly diminished unless dithiothreitol or 2-mercaptoethanol was included in the reaction mixture. Reagents such as Hg2+ or iodoacetate strongly inhibited the enzyme. The nuclease hydrolysed both double-stranded and single-stranded DNA, showing greater affinity for double-stranded DNA, and no detectable hydrolysis of RNA. The enzyme produced nicks in double-stranded DNA, generating 3'-hydroxy and 5'-phosphate termini, and degraded circular DNA.
Project description:Acarbose, a pseudotetrasaccharide produced by several strains of Actinoplanes and Streptomyces, is an α-glucosidase inhibitor clinically used to control type II diabetes. Bioinformatic analysis of the biosynthetic gene clusters of acarbose in Actinoplanes sp. SE50/110 (the acb cluster) and Streptomyces glaucescens GLA.O (the gac cluster) revealed their distinct genetic organizations and presumably biosynthetic pathways. However, to date, only the acarbose pathway in the SE50/110 strain has been extensively studied. Here, we report that GacI, one of the proteins that appear to be different between the two pathways, is a bifunctional glycosyltransferase family 5 (GT5)-phosphatase (PP) enzyme that functions at two different steps in acarbose biosynthesis in S. glaucescens GLA.O. In the acb pathway, the GT and the PP reactions are performed by two different enzymes. Truncated GacI proteins having only the GT or the PP domain showed comparable catalytic activity with the full-length GacI, indicating that domain separation does not significantly affect their respective catalytic activity. GacI, which is widely distributed in many Streptomyces, represents the first example of naturally occurring GT5-PP bifunctional enzymes biochemically characterized.