Dataset Information

Epithelial EZH2 serves as an epigenetic determinant in experimental colitis by inhibiting TNF?-mediated inflammation and apoptosis.

ABSTRACT: Epithelial barrier disruption is a major cause of inflammatory bowel disease (IBD); however, the mechanism through which epigenetic regulation modulates intestinal epithelial integrity remains largely undefined. Here we show that EZH2, the catalytic subunit of polycomb repressive complex (PRC2), is indispensable for maintaining epithelial cell barrier integrity and homeostasis under inflammatory conditions. In accordance with reduced EZH2 expression in patients, the inactivation of EZH2 in IECs sensitizes mice to DSS- and TNBS-induced experimental colitis. Conversely, EZH2 overexpression in the intestinal epithelium renders mice more resistant to colitis. Mechanistically, the genes encoding TRAF2/5 are held in a finely tuned bivalent status under inflammatory conditions. EZH2 deficiency potentiates the expression of these genes to enhance TNF?-induced NF-?B signaling, thereby leading to uncontrolled inflammation. More importantly, we show that EZH2 depletion compromises the protective role of NF-?B signaling in cell survival by directly up-regulating ITCH, a well-known E3 ligase that degrades the c-FLIP protein. Thus, our findings highlight an epigenetic mechanism by which EZH2 integrates the multifaceted effects of TNF? signaling to promote the inflammatory response and apoptosis in colitis.

SUBMITTER: Liu Y

PROVIDER: S-EPMC5441742 | biostudies-literature | 2017 May

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Epithelial EZH2 serves as an epigenetic determinant in experimental colitis by inhibiting TNFα-mediated inflammation and apoptosis.

Liu Yongfeng Y Peng Junjie J Sun Tongyu T Li Ni N Zhang Le L Ren Jiale J Yuan Huairui H Kan Shan S Pan Qiang Q Li Xiang X Ding Yufeng Y Jiang Min M Cong Xiaoji X Tan Minjia M Ma Yushui Y Fu Da D Cai Sanjun S Xiao Yichuan Y Wang Xiaoming X Qin Jun J

Proceedings of the National Academy of Sciences of the United States of America 20170424 19

Epithelial barrier disruption is a major cause of inflammatory bowel disease (IBD); however, the mechanism through which epigenetic regulation modulates intestinal epithelial integrity remains largely undefined. Here we show that EZH2, the catalytic subunit of polycomb repressive complex (PRC2), is indispensable for maintaining epithelial cell barrier integrity and homeostasis under inflammatory conditions. In accordance with reduced EZH2 expression in patients, the inactivation of EZH2 in IECs ...[more]

PMID: 28439030

Similar Datasets

Project description:The successful repair and renewal of alveolar epithelial cells are critical steps in prohibiting the accumulation of myofibroblasts and deposition of extracellular matrix in pulmonary fibrogenesis. MicroRNAs (miRNAs) are multi-focal regulators involved in the lung repair process. The contribution of miRNAs to epithelial maintenance and renewal is incompletely understood. We provide evidence that miR-29c on type 2 alveolar epithelial cells (AEC2s) are important for inhibiting AEC2 apoptosis and promoting AEC2 renewal, thus restraining the degree of fibrosis. MiR-29c was lower in AEC2s from lungs of idiopathic pulmonary fibrosis (IPF) individuals than from healthy lungs. Epithelial cells overexpressing miR-29c showed higher proliferative rate and viability. MiR-29c was protective against epithelial apoptosis by targeting Foxo3a. Both overexpression of miR-29c conventionally and AEC2s specifically led to less fibrosis and better recovery. Furthermore, loss of miR-29c in AEC2s resulted in higher apoptosis and reduced epithelial renewal than in control animals. Thus, miR-29c maintains epithelial integrity and promotes recovery from lung injury, attenuating lung fibrosis in mice. The miR-29c overexpression mouse epithelial cell line was generated based on the strategy described before38. MiR-29c lentiviral construct was generated as follows: a region of 131 nucleotides containing pre-mmu-miR-29c was amplified from mouse genomic DNA by using the following primers: 5’ MIR-29c: GTCGGTTAACATCTCTTACACAGG and 3’ MIR-29c: ACACCTCGAGGATCCTGAGGCTGGT. They were then cloned into the HpaI/XhoI sites of a pSico vector62, named pSico-miR-29c. Viral particles were produced by calcium phosphate–mediated transfection into 293T cells as described63. Lentiviral supernatants were collected 48 hours after transfection, passed through a 0.22-μm filter, and used directly to infect MLE 12 cells. GFP-positive cells were sorted 2-3 days after infection and resulted in MLE 12-SicoGFP and MLE 12-miR-29cGFP cells. Recombinant adenoviral stocks expressing Cre recombinase were purchased from the Gene Transfer Vector Core facility of University of Iowa College of Medicine (Iowa City, IA). Infections of GFP-positive cells were performed by using 100 plaque-forming units of virus per cell. Four days after adenovirus infections, the GPF-negative cells were sorted from GFPpos infected with adeno-Cre as Mlesico and Mle29c cells.

Dataset Information

Epithelial EZH2 serves as an epigenetic determinant in experimental colitis by inhibiting TNF?-mediated inflammation and apoptosis.

Publications

Epithelial EZH2 serves as an epigenetic determinant in experimental colitis by inhibiting TNFα-mediated inflammation and apoptosis.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure