Dataset Information

MiR-29c attenuates pulmonary fibrosis by promoting epithelial renewal and inhibiting epithelial apoptosis

ABSTRACT: The successful repair and renewal of alveolar epithelial cells are critical steps in prohibiting the accumulation of myofibroblasts and deposition of extracellular matrix in pulmonary fibrogenesis. MicroRNAs (miRNAs) are multi-focal regulators involved in the lung repair process. The contribution of miRNAs to epithelial maintenance and renewal is incompletely understood. We provide evidence that miR-29c on type 2 alveolar epithelial cells (AEC2s) are important for inhibiting AEC2 apoptosis and promoting AEC2 renewal, thus restraining the degree of fibrosis. MiR-29c was lower in AEC2s from lungs of idiopathic pulmonary fibrosis (IPF) individuals than from healthy lungs. Epithelial cells overexpressing miR-29c showed higher proliferative rate and viability. MiR-29c was protective against epithelial apoptosis by targeting Foxo3a. Both overexpression of miR-29c conventionally and AEC2s specifically led to less fibrosis and better recovery. Furthermore, loss of miR-29c in AEC2s resulted in higher apoptosis and reduced epithelial renewal than in control animals. Thus, miR-29c maintains epithelial integrity and promotes recovery from lung injury, attenuating lung fibrosis in mice. The miR-29c overexpression mouse epithelial cell line was generated based on the strategy described before38. MiR-29c lentiviral construct was generated as follows: a region of 131 nucleotides containing pre-mmu-miR-29c was amplified from mouse genomic DNA by using the following primers: 5’ MIR-29c: GTCGGTTAACATCTCTTACACAGG and 3’ MIR-29c: ACACCTCGAGGATCCTGAGGCTGGT. They were then cloned into the HpaI/XhoI sites of a pSico vector62, named pSico-miR-29c. Viral particles were produced by calcium phosphate–mediated transfection into 293T cells as described63. Lentiviral supernatants were collected 48 hours after transfection, passed through a 0.22-μm filter, and used directly to infect MLE 12 cells. GFP-positive cells were sorted 2-3 days after infection and resulted in MLE 12-SicoGFP and MLE 12-miR-29cGFP cells. Recombinant adenoviral stocks expressing Cre recombinase were purchased from the Gene Transfer Vector Core facility of University of Iowa College of Medicine (Iowa City, IA). Infections of GFP-positive cells were performed by using 100 plaque-forming units of virus per cell. Four days after adenovirus infections, the GPF-negative cells were sorted from GFPpos infected with adeno-Cre as Mlesico and Mle29c cells.

ORGANISM(S): Mus musculus

PROVIDER: GSE94070 | GEO | 2020/01/20

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:We performed transcriptomic profiling of freshly isolated primary adult human alveolar epithelial type 2 cells (AEC2s), their isogenic cultured progeny, and human induced pluripotent stem cell-derived AEC2s (iAEC2s). Distal lung preparations from adult donor lung explants from two individuals were cryopreserved using methods we have previously described. Primary AEC2s were purified using fluorescence activated cell sorting (FACS) to isolate cells co-expressing EPCAM and HTII-280. To establish cultures of primary AEC2s, these cells were combined with MRC5 fibroblasts at an 1:10 ratio on cell culture inserts in CK+DCI medium. iAEC2s were derived using our previously published lung directed differentiation protocol. We used the SPC2 human iPSC line and specifically the SPC2-ST-B2 (SFTPC tdT/WT ) clone containing a SFTPC tdTomato knock-in reporter. SFTPC tdTomato+ cells were sorted on day 41 of differentiation. iAEC2s were single-cell passaged in self-renewing feeder-free 3D cultures approximately every 2 weeks. We used the 10X Chromium System to generate single-cell transcriptomic data from 5 samples prepared in parallel and sequenced on the same day. We profiled (a) preculture primary AEC2s, (b) cultured primary AEC2s, (c) 3D feeder-free iAEC2s, (d) feeder-free iAEC2 cultured on cell culture inserts, and (e) iAEC2s cultured on cell inserts with MRC5 fibroblasts. The cultured primary AEC2 samples and the iAEC2 sample co-cultured with MRC5s were sorted for live EPCAM+ cells prior to encapsulation. All other samples were sorted for live cells. We find that although each population (fresh, primary cultured, and iPSC-derived AEC2s) occupies a distinct transcriptomic space, both cultured primary AEC2s and cultured feeder-free iAEC2s closely resemble their primary pre-cultured counterparts. We also find a continuum of progressively more proliferative states (from fresh primary to cultured primary to cultured iAEC2s) inversely associated with progressively less mature AEC2 states.

Dataset Information

MiR-29c attenuates pulmonary fibrosis by promoting epithelial renewal and inhibiting epithelial apoptosis

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets