Dataset Information

Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

ABSTRACT: Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34?bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

SUBMITTER: Gao Z

PROVIDER: S-EPMC5517575 | biostudies-literature | 2017 Jul

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

Gao Zitong Z Liu Yang Y Wang Xiaoyue X Song Jingyuan J Chen Shilin S Ragupathy Subramanyam S Han Jianping J Newmaster Steven G SG

Scientific reports 20170719 1

Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTA ...[more]

PMID: 28724933

Similar Datasets

Project description:BACKGROUND: Herbal products available to consumers in the marketplace may be contaminated or substituted with alternative plant species and fillers that are not listed on the labels. According to the World Health Organization, the adulteration of herbal products is a threat to consumer safety. Our research aimed to investigate herbal product integrity and authenticity with the goal of protecting consumers from health risks associated with product substitution and contamination. METHODS: We used DNA barcoding to conduct a blind test of the authenticity for (i) 44 herbal products representing 12 companies and 30 different species of herbs, and (ii) 50 leaf samples collected from 42 herbal species. Our laboratory also assembled the first standard reference material (SRM) herbal barcode library from 100 herbal species of known provenance that were used to identify the unknown herbal products and leaf samples. RESULTS: We recovered DNA barcodes from most herbal products (91%) and all leaf samples (100%), with 95% species resolution using a tiered approach (rbcL + ITS2). Most (59%) of the products tested contained DNA barcodes from plant species not listed on the labels. Although we were able to authenticate almost half (48%) of the products, one-third of these also contained contaminants and or fillers not listed on the label. Product substitution occurred in 30/44 of the products tested and only 2/12 companies had products without any substitution, contamination or fillers. Some of the contaminants we found pose serious health risks to consumers. CONCLUSIONS: Most of the herbal products tested were of poor quality, including considerable product substitution, contamination and use of fillers. These activities dilute the effectiveness of otherwise useful remedies, lowering the perceived value of all related products because of a lack of consumer confidence in them. We suggest that the herbal industry should embrace DNA barcoding for authenticating herbal products through testing of raw materials used in manufacturing products. The use of an SRM DNA herbal barcode library for testing bulk materials could provide a method for 'best practices? in the manufacturing of herbal products. This would provide consumers with safe, high quality herbal products.

Project description:Smithia conferta Sm. is an annual herb widely used in Indian traditional medical practice and commonly known as "Lakshman booti" in Sanskrit. Morphological resemblance among the species of genus Smithia Aiton. leads to inaccurate identification and adulteration. This causes inconsistent therapeutic effects and also affects the quality of herbal medicine.This study aimed to generate potential barcode for authentication of S. conferta and its adulterants through DNA barcoding technique.Genomic DNA extracted from S. conferta and its adulterants was used as templates for polymerase chain reaction amplification of the barcoding regions. The amplicons were directed for sequencing, and species identification was conducted using BLASTn and unweighted pair-group method with arithmetic mean trees. In addition, the secondary structures of internal transcribed spacer (ITS) 2 region were predicted.The nucleotide sequence of ITS provides species-specific single nucleotide polymorphisms and sequence divergence (22%) than psbA-trnH (10.9%) and rbcL (3.1%) sequences. The ITS barcode indicates that S. conferta and Smithia sensitiva are closely related compared to other species.ITS is the most applicable barcode for molecular authentication of S. conferta, and further chloroplast barcodes should be tested for phylogenetic analysis of genus Smithia.The present investigation is the first effort of utilization of DNA barcode for molecular authentication of S. conferta and its adulterants. Also, this study expanded the application of the ITS2 sequence data in the authentication. The ITS has been proved as a potential and reliable candidate barcode for the authentication of S. conferta. Abbreviations used: BLASTn: Basic Local Alignment Search Tool for Nucleotide; MEGA: Molecular Evolutionary Genetic Analysis; EMBL: European Molecular Biology Laboratory; psbA-trnH: Photosystem II protein D1- stuctural RNA: His tRNA gene; rbcL: Ribulose 1,5 bi-phosphate carboxylase/oxygenase large subunit gene.

Project description:Background and objective: Best-value biological medicines may generate competition in the off-patent biologicals market, resulting in having more resources available to provide patients with access to necessary medicines while maintaining high-quality care. Belgium is a country known to have low biosimilar market shares, suggesting a malfunctioning market for off-patent biologicals. This study aims to gain an in-depth understanding of the Belgian off-patent biologicals market, by looking at the evolution in volumes and costs of the relevant products in the market. Methods: This study included a combination of quantitative and qualitative research methods. The quantitative part of this study consisted of the analysis of market data obtained by the National Institute for Health and Disability Insurance (NIHDI) for all relevant products in the Belgian off-patent biologicals market (i.e. TNF-inhibitors, insulins, granulocyte colony-stimulating factors, epoetins, rituximab, trastuzumab). In addition, for the qualitative part of this study, semi-structured interviews with Belgian stakeholders were conducted between December 2019 and March 2020. Results: Belgian market data and stakeholder perceptions suggest a suboptimal market environment for off-patent biological and biosimilar medicines. Shifts are observed after loss of exclusivities of originator biologicals toward second-generation products or new therapeutic class products, at a higher cost and often limited added value. Moreover, cost reductions for off-patent biologicals after biosimilar market entry are mainly determined by mandatory price reductions applicable to both originator and biosimilar products, and not by lower prices induced by competition. For products used in the retail setting, significant mandatory price reductions for both originator and reference products with low biosimilar volumes were pointed out as the main reasons for the lack of price competition. For products dispensed in hospitals, the hospital financing system is important. First, it does not always encourage the use of lower cost alternatives. Second, competition mainly takes place at the level of confidential discounts in tenders. Most interviewees acknowledged the lack of a competitive environment, which is not supportive of a sustainable Belgian off-patent biologicals market. Conclusion: Market data and stakeholder perceptions indicate that the sustainability of the Belgian market for off-patent biologicals is challenged. A sustainable market ensures access to biological therapies now and in the future.

Dataset Information

Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

Publications

Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets