Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Occurrence of Synpolydactyly and Omphalocele in a Fetus with a HOXD13 Mutation.

ABSTRACT: Synpolydactyly (SPD) is an autosomal dominant congenital limb disorder due to mutations in HOXD13 . It is a phenotypically heterogeneous condition characterized by syndactyly of the third finger (F3), fourth finger (F4) and/or fourth toe (T4), and fifth toe (T5) with variably associated polydactyly. We report on a mother and fetus with SPD. The mother has a novel mutation (c.708_708delC) in the HOXD13 gene that was also seen in the fetus. However, the fetus had congenital omphalocele in addition to SPD that is an association not reported to date. A chromosomal microarray in the fetus was normal. We report a novel mutation in HOXD13 and document co-occurrence of an omphalocele and SPD in a fetus.

SUBMITTER: Radhakrishnan P

PROVIDER: S-EPMC5548533 | biostudies-literature | 2017 Sep

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Occurrence of Synpolydactyly and Omphalocele in a Fetus with a HOXD13 Mutation.

Radhakrishnan Periyasamy P Nayak Shalini S SS Pai Muralidhar V MV Shukla Anju A Girisha Katta M KM

Journal of pediatric genetics 20170410 3

Synpolydactyly (SPD) is an autosomal dominant congenital limb disorder due to mutations in HOXD13 . It is a phenotypically heterogeneous condition characterized by syndactyly of the third finger (F3), fourth finger (F4) and/or fourth toe (T4), and fifth toe (T5) with variably associated polydactyly. We report on a mother and fetus with SPD. The mother has a novel mutation (c.708_708delC) in the HOXD13 gene that was also seen in the fetus. However, the fetus had congenital omphaloce ...[more]

PMID: 28794915

Similar Datasets

A nonsense mutation in the HOXD13 gene underlies synpolydactyly with incomplete penetrance.

Project description:Synpolydactyly 1 (SPD1; OMIM 186000), also known as type II syndactyly, is a dominantly inherited limb malformation that is characterized by an increased number of digits. SPD1 is most commonly caused by polyalanine repeat expansions in the coding region of the HOXD13 gene, which are believed to show a dominant-negative effect. In addition, missense and out-of-frame deletion mutations in the HOXD13 gene are also known to cause SPD, and the mechanism responsible for the phenotype appears to be haploinsufficiency. Here, we analyzed a large consanguineous family from Pakistan with SPD showing a wide variation in phenotype among affected individuals. We performed genetic linkage analysis, which identified a region on chromosome 2 containing the HOXD13 gene. Haplotype analysis with microsatellite markers suggested segregation of the phenotype with HOXD13 gene with incomplete penetrance. Direct sequencing analysis of HOXD13 gene revealed a nonsense mutation, designated as Q248X. All affected individuals with the severe SPD phenotype are homozygous for the mutation, whereas those with the mild SPD phenotype are heterozygous for the mutation. Furthermore, some unaffected individuals also carry the mutation in the heterozygous state, showing incomplete penetrance. Our results show the first nonsense mutation in the HOXD13 gene underlying a severe form of SPD in the homozygous state, and a milder form of SPD with ?50% penetrance in the heterozygous state, most likely because of the production of 50% of protein compared with normal individuals.

| S-EPMC4296310 | biostudies-literature

A 117-kb microdeletion removing HOXD9-HOXD13 and EVX2 causes synpolydactyly.

Project description:Studies in mouse and chick have shown that the 5' HoxD genes play major roles in the development of the limbs and genitalia. In humans, mutations in HOXD13 cause the dominantly inherited limb malformation synpolydactyly (SPD). Haploinsufficiency for the 5' HOXD genes has recently been proposed to underlie the monodactyly and penoscrotal hypoplasia in two children with chromosomal deletions encompassing the entire HOXD cluster. Similar deletions, however, have previously been associated with split-hand/foot malformation (SHFM), including monodactyly. Here we report a father and daughter with SPD who carry a 117-kb microdeletion at the 5' end of the HOXD cluster. By sequencing directly across the deletion breakpoint, we show that this microdeletion removes only HOXD9-HOXD13 and EVX2. We also report a girl with bilateral split foot and a chromosomal deletion that includes the entire HOXD cluster and extends approximately 5 Mb centromeric to it. Our findings indicate that haploinsufficiency for the 5' HOXD genes causes not SHFM but SPD and point to the presence of a novel locus for SHFM in the interval between EVX2 and D2S294. They also suggest that there is a regulatory region, upstream of the HOXD cluster, that is responsible for activating the cluster as a whole.

| S-EPMC384929 | biostudies-literature

Synpolydactyly phenotypes correlate with size of expansions in HOXD13 polyalanine tract.

Project description:Synpolydactyly (SPD) is a dominantly inherited congenital limb malformation. Typical cases have 3/4 finger and 4/5 toe syndactyly, with a duplicated digit in the syndactylous web, but incomplete penetrance and variable expressivity are common. The condition has recently been shown to be caused by expansions of an imperfect trinucleotide repeat sequence encoding a 15-residue polyalanine tract in HOXD13. We have studied 16 new and 4 previously published SPD families, with between 7 and 14 extra residues in the tract, to analyze the molecular basis for the observed variation in phenotype. Although there is no evidence of change in expansion size within families, even over six generations, there is a highly significant increase in the penetrance and severity of phenotype with increasing expansion size, affecting both hands (P = 0.012) and feet (P < 0. 00005). Affected individuals from a family with a 14-alanine expansion, the largest so far reported, all have a strikingly similar and unusually severe limb phenotype, involving the first digits and distal carpals. Affected males from this family also have hypospadias, not previously described in SPD, but consistent with HOXD13 expression in the developing genital tubercle. The remarkable correlation between phenotype and expansion size suggests that expansion of the tract leads to a specific gain of function in the mutant HOXD13 protein, and has interesting implications for the role of polyalanine tracts in the control of transcription.

| S-EPMC23843 | biostudies-literature

Synpolydactyly and HOXD13 polyalanine repeat: addition of 2 alanine residues is without clinical consequences.

Project description:BACKGROUND: Type II syndactyly or synpolydactyly (SPD) is clinically very heterogeneous, and genetically three distinct SPD conditions are known and have been designated as SPD1, SPD2 and SPD3, respectively. SPD1 type is associated with expansion mutations in HOXD13, resulting in an addition of > or = 7 alanine residues to the polyalanine repeat. It has been suggested that expansions < or = 6 alanine residues go without medical attention, as no such expansion has ever been reported with the SPD1 phenotype. METHODS: We describe a large Pakistani and an Indian family with SPD. We perform detailed clinical and molecular analyses to identify the genetic basis of this malformation. RESULTS: We have identified four distinct clinical categories for the SPD1 phenotype observed in the affected subjects in both families. Next, we show that a milder foot phenotype, previously described as a separate entity, is in fact a part of the SPD1 phenotypic spectrum. Then, we demonstrate that the phenotype in both families segregates with an identical expansion mutation of 21 bp in HOXD13. Finally, we show that the HOXD13 polyalanine repeat is polymorphic, and the expansion of 2 alanine residues, evident in unaffected subjects of both families, is without clinical consequences. CONCLUSION: It is the first molecular evidence supporting the hypothesis that expansion of < or = 6 alanine residues in the HOXD13 polyalanine repeat is not associated with the SPD1 phenotype.

| S-EPMC2222244 | biostudies-literature

A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family.

Project description:BACKGROUND:Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. METHODS:We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. RESULTS:Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. CONCLUSION:Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

| S-EPMC6929446 | biostudies-literature

Clinical and genetic analysis in Chinese families with synpolydactyly, and cellular localization of HOXD13 with different length of polyalanine tract

Project description:Synpolydactyly (SPD) is caused by mutations in the transcription factor gene HOXD13. Such mutations include polyalanine expansion (PAE), but further study is required for the phenotypic spectrum characteristics of HOXD13 PAE. We investigated four unrelated Chinese families with significant limb malformations. Three PAEs were found in the HOXD13 polyalanine coding region: c.172_192dup (p.Ala58_Ala64dup) in Family 1, c.169_192dup (p.Ala57_Ala64dup) in Family 2, and c.183_210dup (p.Ala62_Ala70dup) in Family 3 and Family 4. Interestingly, we identified a new manifestation of preaxial polydactyly in both hands in a pediatric patient with an expansion of seven alanines, a phenotype not previously noted in SPD patients. Comparing with the wild-type cells and mutant cells with polyalanine contractions (PACs), the HOXD13 protein with a PAE of nine-alanine or more was difficult to enter the nucleus, and easy to form inclusion bodies in the cytoplasm, and with the increase of PAE, the more inclusion bodies were formed. This study not only expanded the phenotypic spectrum of SPD, but also enriched our understanding of its pathogenic mechanisms.

| S-EPMC10073534 | biostudies-literature

A Novel Missense Variant of HOXD13 Caused Atypical Synpolydactyly by Impairing the Downstream Gene Expression and Literature Review for Genotype-Phenotype Correlations.

Project description:Synpolydactyly (SPD) is a hereditary congenital limb malformation with distinct syndactyly designated as SPD1, SPD2, and SPD3. SPD1 is caused by mutations of HOXD13, which is a homeobox transcription factor crucial for limb development. More than 143 SPD patients have been reported to carry HOXD13 mutations, but there is a lack of genotype-phenotype correlation. We report a novel missense mutation of c. 925A > T (p.I309F) in an individual with atypical synpolydactyly inherited from her father with mild clinodactyly and three other different alanine insertion mutations in HOXD13 identified by whole exome sequencing (WES) in 12 Chinese SPD families. Unlike polyalanine extension, which tends to form α-helix and causes protein aggregation in the cytoplasm as shown by molecular simulation and immunofluorescence, the c. 925A > T mutation impairs downstream transcription of EPHA7. We compiled literature findings and analyzed genotype-phenotype features in 173 SPD individuals of 53 families, including 12 newly identified families. Among the HOXD13-related individuals, mutations were distributed in three regions: polyalanine, homeobox, and non-homeobox. Polyalanine extension was the most common variant (45%), followed by missense mutations (32%) mostly in the homeobox compared with the loss-of-function (LOF) variants more likely in non-homeobox. Furthermore, a more severe degree and classic SPD were associated with polyalanine mutations although missense variants were associated with brachydactyly and syndactyly in hands and feet and LOF variants with clinodactyly in hands. Our study broadens the HOXD13 mutation spectrum and reveals the profile of three different variants and their severity of SPD, the genotype-phenotype correlation related to the HOXD13 mutation site provides clinical insight, including for genetic counseling.

| S-EPMC8579070 | biostudies-literature

Fork stalling and template switching as a mechanism for polyalanine tract expansion affecting the DYC mutant of HOXD13, a new murine model of synpolydactyly.

Project description:Polyalanine expansion diseases are proposed to result from unequal crossover of sister chromatids that increases the number of repeats. In this report we suggest an alternative mechanism we put forward while we investigated a new spontaneous mutant that we named "Dyc" for "Digit in Y and Carpe" phenotype. Phenotypic analysis revealed an abnormal limb patterning similar to that of the human inherited congenital disease synpolydactyly (SPD) and to the mouse mutant model Spdh. Both human SPD and mouse Spdh mutations affect the Hoxd13 gene within a 15-residue polyalanine-encoding repeat in the first exon of the gene, leading to a dominant negative HOXD13. Genetic analysis of the Dyc mutant revealed a trinucleotide expansion in the polyalanine-encoding region of the Hoxd13 gene resulting in a 7-alanine expansion. However, unlike the Spdh mutation, this expansion cannot result from a simple duplication of a short segment. Instead, we propose the fork stalling and template switching (FosTeS) described for generation of nonrecurrent genomic rearrangements as a possible mechanism for the Dyc polyalanine extension, as well as for other polyalanine expansions described in the literature and that could not be explained by unequal crossing over.

| S-EPMC2746147 | biostudies-literature

Isolated brachydactyly type E caused by a HOXD13 nonsense mutation: a case report.

Project description:BACKGROUND: Brachydactyly type E (BDE; MIM#113300) is characterized by shortening of the metacarpal, metatarsal, and often phalangeal bones, and predominantly affects postaxial ray(s) of the limb. BDE may occur as an isolated trait or as part of a syndrome. Isolated BDE is rare and in the majority of cases the molecular pathogenesis has so far not been resolved. Originally, the molecular cause of isolated BDE has been unravelled in 2 families and shown to result from heterozygous missense mutations in the homeodomain of the HOXD13 gene. Since the initial manuscript, one further HOXD13 mutation has been reported only in a single family manifesting isolated BDE. CASE PRESENTATION: In this paper, we report on a Polish family exhibiting isolated BDE caused by a novel nonsense heterozygous HOXD13 mutation. We investigated a Polish female proband and her father, both affected by isolated BDE, in whom we identified a nonsense heterozygous mutation c.820C > T(p.R274X) in the HOXD13 gene. So far, only two missense HOXD13 substitutions (p.S308C and p.I314L), localized within the homeodomain of the HOXD13 transcription factor, as well as a single nonsense mutation (p.E181X) were associated with BDE. Both missense changes were supposed to alter DNA binding affinity of the protein. CONCLUSION: The variant p.R274X identified in our proband is the fourth HOXD13 mutation, and the second truncating (nonsense) mutation, reported to result in typical isolated BDE. We refer our clinical and molecular findings to the previously described HOXD13 associated phenotypes and mutations.

| S-EPMC3278352 | biostudies-literature

Evx2-Hoxd13 intergenic region restricts enhancer association to Hoxd13 promoter.

Project description:Expression of Hox genes is tightly regulated in spatial and temporal domains. Evx2 is located next to Hoxd13 within 8 kb on the opposite DNA strand. Early in development, the pattern of Hoxd13 expression resembles that of Evx2 in limb and genital buds. After 10 dpc, however, Evx2 begins to be expressed in CNS as well. We analyzed the region responsible for these differences using ES cell techniques, and found that the intergenic region between Evx2 and Hoxd13 behaves as a boundary element that functions differentially in space and time, specifically in the development of limbs, genital bud, and brain. This boundary element comprises a large sequence spanning several kilobases that can be divided into at least two units: a constitutive boundary element, which blocks transcription regulatory influences from the chromosomal environment, and a regulatory element, which controls the function of the constitutive boundary element in time and space.

| S-EPMC1766471 | biostudies-literature