Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Selecting Optimal Peptides for Targeted Proteomic Experiments in Human Plasma Using In Vitro Synthesized Proteins as Analytical Standards.

ABSTRACT: In targeted proteomics, the development of robust methodologies is dependent upon the selection of a set of optimal peptides for each protein-of-interest. Unfortunately, predicting which peptides and respective product ion transitions provide the greatest signal-to-noise ratio in a particular assay matrix is complicated. Using in vitro synthesized proteins as analytical standards, we report here an empirically driven method for the selection of said peptides in a human plasma assay matrix.

SUBMITTER: Bollinger JG

PROVIDER: S-EPMC5614897 | biostudies-literature | 2016

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Publications

Selecting Optimal Peptides for Targeted Proteomic Experiments in Human Plasma Using In Vitro Synthesized Proteins as Analytical Standards.

Bollinger James G JG Stergachis Andrew B AB Johnson Richard S RS Egertson Jarrett D JD MacCoss Michael J MJ

Methods in molecular biology (Clifton, N.J.) 20160101

In targeted proteomics, the development of robust methodologies is dependent upon the selection of a set of optimal peptides for each protein-of-interest. Unfortunately, predicting which peptides and respective product ion transitions provide the greatest signal-to-noise ratio in a particular assay matrix is complicated. Using in vitro synthesized proteins as analytical standards, we report here an empirically driven method for the selection of said peptides in a human plasma assay matrix. ...[more]

PMID: 26867746

Similar Datasets

Rapid empirical discovery of optimal peptides for targeted proteomics.

Project description:We report a method for high-throughput, cost-efficient empirical discovery of optimal proteotypic peptides and fragment ions for targeted proteomics applications using in vitro-synthesized proteins. We demonstrate the approach using human transcription factors, which are typically difficult, low-abundance targets and empirically derived proteotypic peptides for 98% of the target proteins. We show that targeted proteomic assays developed using our approach facilitate robust in vivo quantification of human transcription factors.

| S-EPMC3227787 | biostudies-literature

2C-B-Fly-NBOMe Metabolites in Rat Urine, Human Liver Microsomes and C. elegans: Confirmation with Synthesized Analytical Standards.

Project description:Compounds from the N-benzylphenethylamine (NBPEA) class of novel psychoactive substances are being increasingly utilized in neurobiological and clinical research, as diagnostic tools, or for recreational purposes. To understand the pharmacology, safety, or potential toxicity of these substances, elucidating their metabolic fate is therefore of the utmost interest. Several studies on NBPEA metabolism have emerged, but scarce information about substances with a tetrahydrobenzodifuran ("Fly") moiety is available. Here, we investigated the metabolism of 2-(8-bromo-2,3,6,7-tetrahydrobenzo[1,2-b:4,5-b']difuran-4-yl)-N-(2-methoxybenzyl)ethan-1-amine (2C-B-Fly-NBOMe) in three different systems: isolated human liver microsomes, Cunninghamella elegans mycelium, and in rats in vivo. Phase I and II metabolites of 2C-B-Fly-NBOMe were first detected in an untargeted screening and identified by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Several hypothesized metabolites were then synthesized as reference standards; knowledge of their fragmentation patterns was utilized for confirmation or tentative identification of isomers. Altogether, thirty-five phase I and nine phase II 2C-B-Fly-NBOMe metabolites were detected. Major detected metabolic pathways were mono- and poly-hydroxylation, O-demethylation, oxidative debromination, and to a lesser extent also N-demethoxybenzylation, followed by glucuronidation and/or N-acetylation. Differences were observed for the three used media. The highest number of metabolites and at highest concentration were found in human liver microsomes. In vivo metabolites detected from rat urine included two poly-hydroxylated metabolites found only in this media. Mycelium matrix contained several dehydrogenated, N-oxygenated, and dibrominated metabolites.

| S-EPMC8624686 | biostudies-literature

Deep2Full: Evaluating strategies for selecting the minimal mutational experiments for optimal computational predictions of deep mutational scan outcomes.

Project description:Performing a complete deep mutational scan with all single point mutations may not be practical, and may not even be required, especially if predictive computational models can be developed. Computational models are however naive to cellular response in the myriads of assay-conditions. In a realistic paradigm of assay context-aware predictive hybrid models that combine minimal experimental data from deep mutational scans with structure, sequence information and computational models, we define and evaluate different strategies for choosing this minimal set. We evaluated the trivial strategy of a systematic reduction in the number of mutational studies from 85% to 15%, along with several others about the choice of the types of mutations such as random versus site-directed with the same 15% data completeness. Interestingly, the predictive capabilities by training on a random set of mutations and using a systematic substitution of all amino acids to alanine, asparagine and histidine (ANH) were comparable. Another strategy we explored, augmenting the training data with measurements of the same mutants at multiple assay conditions, did not improve the prediction quality. For the six proteins we analyzed, the bin-wise error in prediction is optimal when 50-100 mutations per bin are used in training the computational model, suggesting that good prediction quality may be achieved with a library of 500-1000 mutations.

| S-EPMC6954071 | biostudies-literature

Analytical utility of mass spectral binning in proteomic experiments by SPectral Immonium Ion Detection (SPIID).

Project description:Unambiguous identification of tandem mass spectra is a cornerstone in mass-spectrometry-based proteomics. As the study of post-translational modifications (PTMs) by means of shotgun proteomics progresses in depth and coverage, the ability to correctly identify PTM-bearing peptides is essential, increasing the demand for advanced data interpretation. Several PTMs are known to generate unique fragment ions during tandem mass spectrometry, the so-called diagnostic ions, which unequivocally identify a given mass spectrum as related to a specific PTM. Although such ions offer tremendous analytical advantages, algorithms to decipher MS/MS spectra for the presence of diagnostic ions in an unbiased manner are currently lacking. Here, we present a systematic spectral-pattern-based approach for the discovery of diagnostic ions and new fragmentation mechanisms in shotgun proteomics datasets. The developed software tool is designed to analyze large sets of high-resolution peptide fragmentation spectra independent of the fragmentation method, instrument type, or protease employed. To benchmark the software tool, we analyzed large higher-energy collisional activation dissociation datasets of samples containing phosphorylation, ubiquitylation, SUMOylation, formylation, and lysine acetylation. Using the developed software tool, we were able to identify known diagnostic ions by comparing histograms of modified and unmodified peptide spectra. Because the investigated tandem mass spectra data were acquired with high mass accuracy, unambiguous interpretation and determination of the chemical composition for the majority of detected fragment ions was feasible. Collectively we present a freely available software tool that allows for comprehensive and automatic analysis of analogous product ions in tandem mass spectra and systematic mapping of fragmentation mechanisms related to common amino acids.

| S-EPMC4125726 | biostudies-literature

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)

2009-06-03 | GSE14695 | GEO

MSstatsQC: Longitudinal System Suitability Monitoring and Quality Control for Targeted Proteomic Experiments.

Project description:Selected Reaction Monitoring (SRM) is a powerful tool for targeted detection and quantification of peptides in complex matrices. An important objective of SRM is to obtain peptide quantifications that are (1) suitable for the investigation, and (2) reproducible across laboratories and runs. The first objective is achieved by system suitability tests (SST), which verify that mass spectrometric instrumentation performs as specified. The second objective is achieved by quality control (QC), which provides in-process quality assurance of the sample profile. A common aspect of SST and QC is the longitudinal nature of the data. Although SST and QC have received a lot of attention in the proteomic community, the currently used statistical methods are limited. This manuscript improves upon the statistical methodology for SST and QC that is currently used in proteomics. It adapts the modern methods of longitudinal statistical process control, such as simultaneous and time weighted control charts and change point analysis, to SST and QC of SRM experiments, discusses their advantages, and provides practical guidelines. Evaluations on simulated data sets, and on data sets from the Clinical Proteomics Technology Assessment for Cancer (CPTAC) consortium, demonstrated that these methods substantially improve our ability of real time monitoring, early detection and prevention of chromatographic and instrumental problems. We implemented the methods in an open-source R-based software package MSstatsQC and its web-based graphical user interface. They are available for use stand-alone, or for integration with automated pipelines. Although the examples focus on targeted proteomics, the statistical methods in this manuscript apply more generally to quantitative proteomics.

| S-EPMC5500765 | biostudies-literature

Computational and Analytical Framework for Small RNA Profiling by High-Throughput Sequencing (standards)

Project description:The purpose of this work was to describe a computational and analytical methodology for profiling small RNA by high-throughput sequencing. The datasets here were used to develop synthetic oligoribonucleotides as spike-in standards. We assessed the use of synthetic oligoribonucleotide standards as spike-in controls. These standards can be used to set an objective standard against which to compare samples. Standards were added to the total RNA (100 ug) in the following amounts: Std2 (TATATGCAAGTCCGGCCATAC) 0.01 pmol, Std3 (TAGCTAACGCATATCCGCATC) 0.1 pmol, Std6 (TGAAGCTGACATCGGTCATCC) 1.0 pmol.

2009-06-02 | E-GEOD-14695 | biostudies-arrayexpress

Selecting optimal partitioning schemes for phylogenomic datasets.

Project description:BACKGROUND:Partitioning involves estimating independent models of molecular evolution for different subsets of sites in a sequence alignment, and has been shown to improve phylogenetic inference. Current methods for estimating best-fit partitioning schemes, however, are only computationally feasible with datasets of fewer than 100 loci. This is a problem because datasets with thousands of loci are increasingly common in phylogenetics. METHODS:We develop two novel methods for estimating best-fit partitioning schemes on large phylogenomic datasets: strict and relaxed hierarchical clustering. These methods use information from the underlying data to cluster together similar subsets of sites in an alignment, and build on clustering approaches that have been proposed elsewhere. RESULTS:We compare the performance of our methods to each other, and to existing methods for selecting partitioning schemes. We demonstrate that while strict hierarchical clustering has the best computational efficiency on very large datasets, relaxed hierarchical clustering provides scalable efficiency and returns dramatically better partitioning schemes as assessed by common criteria such as AICc and BIC scores. CONCLUSIONS:These two methods provide the best current approaches to inferring partitioning schemes for very large datasets. We provide free open-source implementations of the methods in the PartitionFinder software. We hope that the use of these methods will help to improve the inferences made from large phylogenomic datasets.

| S-EPMC4012149 | biostudies-literature

NITPicker: selecting time points for follow-up experiments.

Project description:BackgroundThe design of an experiment influences both what a researcher can measure, as well as how much confidence can be placed in the results. As such, it is vitally important that experimental design decisions do not systematically bias research outcomes. At the same time, making optimal design decisions can produce results leading to statistically stronger conclusions. Deciding where and when to sample are among the most critical aspects of many experimental designs; for example, we might have to choose the time points at which to measure some quantity in a time series experiment. Choosing times which are too far apart could result in missing short bursts of activity. On the other hand, there may be time points which provide very little information regarding the overall behaviour of the quantity in question.ResultsIn this study, we develop a tool called NITPicker (Next Iteration Time-point Picker) for selecting optimal time points (or spatial points along a single axis), that eliminates some of the biases caused by human decision-making, while maximising information about the shape of the underlying curves. NITPicker uses ideas from the field of functional data analysis. NITPicker is available on the Comprehensive R Archive Network (CRAN) and code for drawing figures is available on Github ( https://github.com/ezer/NITPicker ).ConclusionsNITPicker performs well on diverse real-world datasets that would be relevant for varied biological applications, including designing follow-up experiments for longitudinal gene expression data, weather pattern changes over time, and growth curves.

| S-EPMC6444531 | biostudies-literature

Using Data Independent Acquisition (DIA) to Model High-responding Peptides for Targeted Proteomics Experiments.

Project description:Targeted mass spectrometry is an essential tool for detecting quantitative changes in low abundant proteins throughout the proteome. Although selected reaction monitoring (SRM) is the preferred method for quantifying peptides in complex samples, the process of designing SRM assays is laborious. Peptides have widely varying signal responses dictated by sequence-specific physiochemical properties; one major challenge is in selecting representative peptides to target as a proxy for protein abundance. Here we present PREGO, a software tool that predicts high-responding peptides for SRM experiments. PREGO predicts peptide responses with an artificial neural network trained using 11 minimally redundant, maximally relevant properties. Crucial to its success, PREGO is trained using fragment ion intensities of equimolar synthetic peptides extracted from data independent acquisition experiments. Because of similarities in instrumentation and the nature of data collection, relative peptide responses from data independent acquisition experiments are a suitable substitute for SRM experiments because they both make quantitative measurements from integrated fragment ion chromatograms. Using an SRM experiment containing 12,973 peptides from 724 synthetic proteins, PREGO exhibits a 40-85% improvement over previously published approaches at selecting high-responding peptides. These results also represent a dramatic improvement over the rules-based peptide selection approaches commonly used in the literature.

| S-EPMC4563719 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data