Dataset Information

Novel polymorphisms in TICAM2 and NOD1 associated with tuberculosis progression phenotypes in Ethiopian populations.

ABSTRACT: Background:Infection by Mycobacterium tuberculosis (Mtb) is a necessary but not sufficient cause for tuberculosis (TB). Although numerous studies suggest human genetic variation may influence TB pathogenesis, there is a conspicuous lack of replication, likely due to imprecise phenotype definition. We aimed to replicate novel findings from a Ugandan cohort in Ethiopian populations. Method:We ascertained TB cases and household controls (n = 292) from three different ethnic groups. Latent Mtb infection was determined using Quantiferon to develop reliable TB progression phenotypes. We sequenced exonic regions of TICAM2 and NOD1. Result:Significant novel associations were observed between two variants in NOD1 and TB: rs751770147 [unadjusted p = 7.28 × 10-5] and chr7:30477156(T), a novel variant, [unadjusted p = 1.04 × 10-4]. Two SNPs in TICAM2 were nominally associated with TB, including rs2288384 [unadjusted p = 0.003]. Haplotype-based association tests supported the SNP-based results. Conclusion:We replicated the association of TICAM2 and NOD1 with TB and identified novel genetic associations with TB in Ethiopian populations.

SUBMITTER: Mekonnen E

PROVIDER: S-EPMC5870410 | biostudies-literature | 2018

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

Novel polymorphisms in <i>TICAM2</i> and <i>NOD1</i> associated with tuberculosis progression phenotypes in Ethiopian populations.

Mekonnen E E Bekele E E Stein C M CM

Global health, epidemiology and genomics 20180123

<h4>Background</h4>Infection by <i>Mycobacterium tuberculosis</i> (<i>Mtb</i>) is a necessary but not sufficient cause for tuberculosis (TB). Although numerous studies suggest human genetic variation may influence TB pathogenesis, there is a conspicuous lack of replication, likely due to imprecise phenotype definition. We aimed to replicate novel findings from a Ugandan cohort in Ethiopian populations.<h4>Method</h4>We ascertained TB cases and household controls (<i>n</i> = 292) from three diffe ...[more]

PMID: 29868226

Similar Datasets

Project description:The human FMO2 (flavin-containing monooxygenase 2) gene has been shown to be involved in innate immunity against microbial infections, including tuberculosis (TB), via the modulation of oxidative stress levels. It has also been found to possess a curious loss-of-function mutation (FMO2*1/FMO2*2) that demonstrates a distinctive differentiation in expression, function and ethno-geographic distribution. However, despite evidences of ethnic-specific genetic associations in the inflammatory profile of TB, no studies were done to investigate whether these patterns of variations correlate with evidences for the involvement of FMO2 in antimicrobial immune responses and ethnic differences in the distribution of FMO2 polymorphisms except for some pharmacogenetic data that suggest a potentially deleterious role for the functional variant (FMO2*1). This genetic epidemiological study was designed to investigate whether there is an association between FMO2 polymorphisms and TB, an ancient malady that remains a modern global health concern, in a sub-Saharan Africa setting where there is not only a relatively high co-prevalence of the disease and the ancestral FMO2*1 variant but also where both Mycobcaterium and Homo sapiens are considered to have originated and co-evolved. Blood samples and TB related clinical data were collected from ascertained TB cases and unrelated household controls (n = 292) from 3 different ethnic groups in Ethiopia. Latent Mtb infection was determined using Quantiferon to develop reliable TB progression phenotypes. We sequenced exonic regions of FMO2.We identified for the first time an association between FMO2 and TB both at the SNP and haplotype level. Two novel SNPs achieved a study-wide significance [chr1:171181877(A), p = 3.15E-07, OR = 4.644 and chr1:171165749(T), p = 3.32E-06, OR = 6.825] while multiple SNPs (22) showed nominal signals. The pattern of association suggested a protective effect of FMO2 against both active and latent TB with distinct genetic variants underlying the TB-progression pathway. The results were robust for population stratification. Haplotype-based tests confirmed the SNP-based results with a single haplotype bearing the ancestral-and-functional FMO2*1 "C" allele ("AGCTCTACAATCCCCTCGTTGCGC") explaining the overall association (haplotype-specific-p = 0.000103). Strikingly, not only was FMO2*1 nominally associated with reduced risk to "Active TB" (p = 0.0118, OR = 0.496) but it also does not co-segregate with the 5'-3' flanking top high-TB-risk alleles. The study provides an evidence for the existence of an evolutionary adaptation to an ancient disease based on an ancestral genetic variant acting in a haplotypic framework in Ethiopian populations.

Dataset Information

Novel polymorphisms in TICAM2 and NOD1 associated with tuberculosis progression phenotypes in Ethiopian populations.

Publications

Novel polymorphisms in <i>TICAM2</i> and <i>NOD1</i> associated with tuberculosis progression phenotypes in Ethiopian populations.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets