Dataset Information

An ancestral human genetic variant linked to an ancient disease: A novel association of FMO2 polymorphisms with tuberculosis (TB) in Ethiopian populations provides new insight into the differential ethno-geographic distribution of FMO2*1.

ABSTRACT: The human FMO2 (flavin-containing monooxygenase 2) gene has been shown to be involved in innate immunity against microbial infections, including tuberculosis (TB), via the modulation of oxidative stress levels. It has also been found to possess a curious loss-of-function mutation (FMO2*1/FMO2*2) that demonstrates a distinctive differentiation in expression, function and ethno-geographic distribution. However, despite evidences of ethnic-specific genetic associations in the inflammatory profile of TB, no studies were done to investigate whether these patterns of variations correlate with evidences for the involvement of FMO2 in antimicrobial immune responses and ethnic differences in the distribution of FMO2 polymorphisms except for some pharmacogenetic data that suggest a potentially deleterious role for the functional variant (FMO2*1). This genetic epidemiological study was designed to investigate whether there is an association between FMO2 polymorphisms and TB, an ancient malady that remains a modern global health concern, in a sub-Saharan Africa setting where there is not only a relatively high co-prevalence of the disease and the ancestral FMO2*1 variant but also where both Mycobcaterium and Homo sapiens are considered to have originated and co-evolved. Blood samples and TB related clinical data were collected from ascertained TB cases and unrelated household controls (n = 292) from 3 different ethnic groups in Ethiopia. Latent Mtb infection was determined using Quantiferon to develop reliable TB progression phenotypes. We sequenced exonic regions of FMO2.We identified for the first time an association between FMO2 and TB both at the SNP and haplotype level. Two novel SNPs achieved a study-wide significance [chr1:171181877(A), p = 3.15E-07, OR = 4.644 and chr1:171165749(T), p = 3.32E-06, OR = 6.825] while multiple SNPs (22) showed nominal signals. The pattern of association suggested a protective effect of FMO2 against both active and latent TB with distinct genetic variants underlying the TB-progression pathway. The results were robust for population stratification. Haplotype-based tests confirmed the SNP-based results with a single haplotype bearing the ancestral-and-functional FMO2*1 "C" allele ("AGCTCTACAATCCCCTCGTTGCGC") explaining the overall association (haplotype-specific-p = 0.000103). Strikingly, not only was FMO2*1 nominally associated with reduced risk to "Active TB" (p = 0.0118, OR = 0.496) but it also does not co-segregate with the 5'-3' flanking top high-TB-risk alleles. The study provides an evidence for the existence of an evolutionary adaptation to an ancient disease based on an ancestral genetic variant acting in a haplotypic framework in Ethiopian populations.

SUBMITTER: Mekonnen E

PROVIDER: S-EPMC5628799 | biostudies-literature | 2017

REPOSITORIES: biostudies-literature

ACCESS DATA

Publications

An ancestral human genetic variant linked to an ancient disease: A novel association of FMO2 polymorphisms with tuberculosis (TB) in Ethiopian populations provides new insight into the differential ethno-geographic distribution of FMO2*1.

Mekonnen Ephrem E Bekele Endashaw E

PloS one 20171005 10

The human FMO2 (flavin-containing monooxygenase 2) gene has been shown to be involved in innate immunity against microbial infections, including tuberculosis (TB), via the modulation of oxidative stress levels. It has also been found to possess a curious loss-of-function mutation (FMO2*1/FMO2*2) that demonstrates a distinctive differentiation in expression, function and ethno-geographic distribution. However, despite evidences of ethnic-specific genetic associations in the inflammatory profile o ...[more]

PMID: 28981537

Similar Datasets

Project description:The donkey (Equus asinus) is an important domestic animal that provides a reliable source of protein and method of transportation for many human populations. However, the process of domestication and the dispersal routes of the Chinese donkey are still unclear, as donkey remains are sparse in the archaeological record and often confused with horse remains. To explore the maternal origins and dispersal route of Chinese donkeys, both mitochondrial DNA D-loop and cytochrome b gene fragments of 21 suspected donkey remains from four archaeological sites in China were amplified and sequenced.Molecular methods of species identification show that 17 specimens were donkeys and three samples had the maternal genetic signature of horses. One sample that dates to about 20,000 years before present failed to amplify. In this study, the phylogenetic analysis reveals that ancient Chinese donkeys have high mitochondrial DNA diversity and two distinct mitochondrial maternal lineages, known as the Somali and Nubian lineages. These results indicate that the maternal origin of Chinese domestic donkeys was probably related to the African wild ass, which includes the Nubian wild ass (Equus africanus africanus) and the Somali wild ass (Equus africanus somaliensis). Combined with historical records, the results of this study implied that domestic donkeys spread into west and north China before the emergence of the Han dynasty. The number of Chinese domestic donkeys had increased primarily to meet demand for the expansion of trade, and they were likely used as commodities or for shipping goods along the Silk Road during the Tang Dynasty, when the Silk Road reached its golden age.This study is the first to provide valuable ancient animal DNA evidence for early trade between African and Asian populations. The ancient DNA analysis of Chinese donkeys also sheds light on the dynamic process of the maternal origin, domestication, and dispersal route of ancient Chinese donkeys.

Project description:Two datasets, the geologic record and the genetic content of extant organisms, provide complementary insights into the history of how key molecular components have shaped or driven global environmental and macroevolutionary trends. Changes in global physico-chemical modes over time are thought to be a consistent feature of this relationship between Earth and life, as life is thought to have been optimizing protein functions for the entirety of its approximately 3.8 billion years of history on the Earth. Organismal survival depends on how well critical genetic and metabolic components can adapt to their environments, reflecting an ability to optimize efficiently to changing conditions. The geologic record provides an array of biologically independent indicators of macroscale atmospheric and oceanic composition, but provides little in the way of the exact behaviour of the molecular components that influenced the compositions of these reservoirs. By reconstructing sequences of proteins that might have been present in ancient organisms, we can downselect to a subset of possible sequences that may have been optimized to these ancient environmental conditions. How can one use modern life to reconstruct ancestral behaviours? Configurations of ancient sequences can be inferred from the diversity of extant sequences, and then resurrected in the laboratory to ascertain their biochemical attributes. One way to augment sequence-based, single-gene methods to obtain a richer and more reliable picture of the deep past, is to resurrect inferred ancestral protein sequences in living organisms, where their phenotypes can be exposed in a complex molecular-systems context, and then to link consequences of those phenotypes to biosignatures that were preserved in the independent historical repository of the geological record. As a first step beyond single-molecule reconstruction to the study of functional molecular systems, we present here the ancestral sequence reconstruction of the beta-carbonic anhydrase protein. We assess how carbonic anhydrase proteins meet our selection criteria for reconstructing ancient biosignatures in the laboratory, which we term palaeophenotype reconstruction.This article is part of the themed issue 'Reconceptualizing the origins of life'.

Dataset Information

An ancestral human genetic variant linked to an ancient disease: A novel association of FMO2 polymorphisms with tuberculosis (TB) in Ethiopian populations provides new insight into the differential ethno-geographic distribution of FMO2*1.

Publications

An ancestral human genetic variant linked to an ancient disease: A novel association of FMO2 polymorphisms with tuberculosis (TB) in Ethiopian populations provides new insight into the differential ethno-geographic distribution of FMO2*1.

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets