First Whole-Genome Characterization of Avian Nephritis Virus 2 of Broiler Chicken from Para, Brazil.
Ontology highlight
ABSTRACT:
SUBMITTER: Castro CMO
PROVIDER: S-EPMC6013626 | biostudies-literature | 2018 Jun
REPOSITORIES: biostudies-literature
Publications
First Whole-Genome Characterization of Avian Nephritis Virus 2 of Broiler Chicken from Pará, Brazil.
Castro Ceyla Maria Oeiras CMO Chagas Elaine Hellen Nunes EHN Bezerra Delana Andreza Melo DAM da Silva Sandro Patroca SP Cruz Ana Cecília Ribeiro ACR Sousa Júnior Edivaldo Costa EC Silva René Ribeiro RR Resque Hugo Reis HR Gabbay Yvone Benchimol YB Mascarenhas Joana D'Arc Pereira JDP
Genome announcements 20180621 25
Our results show the first full-genome characterization of avian nephritis virus 2 recovered from stools of broiler chickens at a commercial farm located in Benevides, Pará, Brazil. Nucleotide analyses of whole-genome sequences showed the isolate to be a strain of <i>Avastrovirus 2</i> in the family <i>Astroviridae</i>. ...[more]
Similar Datasets
Project description:Chicken astrovirus (CAstV) and avian nephritis virus (ANV) are enteric viruses of poultry and have infected a wide range of poultry species worldwide, causing runting-stunting syndrome (RSS), which requires virus screening and results in serious economic damage. No confirmed cases have been reported from Bangladesh. In the present study, CAstV and ANV were monitored in Bangladesh. We monitored samples for CAstV and ANV and compared their genomic sequences to other reference strains. We found 8/31 flocks (25.8%) were positive for CAstV, 6/31 flocks (19.3%) had mixed infection of CAstV and ANV, and 1 flock (3.2%) was positive for ANV. Only ANV and a combination of CAstV and ANV were found in broilers and broiler breeders, but CAstV was found in all types of chickens. We isolated two of each from CAstV and ANV through specific pathogen-free chicken embryonated eggs via the yolk sac route. Phylogenetic analysis based on the ORF1b conserved region of CAstV and ANV suggested that the locally circulating strain was closely related to the strains isolated from India and Brazil. This report is the first molecular characterization of CAstV and ANV in Bangladesh. This study highlights that CAstV and ANV are circulating in Bangladeshi poultry.
| S-EPMC8672296 | biostudies-literature
Project description:Avian nephritis virus (ANV) is classified in the Avastroviridae family with disease associations with nephritis, uneven flock growth and runting stunting syndrome (RSS) in chicken and turkey flocks, and other avian species. The whole genome of ANV genotype 3 (ANV-3) of 6959 nucleotides including the untranslated 5' and 3' regions and polyadenylated tail was detected in a metagenomic virome investigation of RSS-affected chicken broiler flocks. This report characterises the ANV-3 genome, identifying partially overlapping open reading frames (ORFs), ORF1a and ORF1b, and an opposing secondary pseudoknot prior to a ribosomal frameshift stemloop structure, with a separate ORF2, whilst observing conserved astrovirus motifs. Phylogenetic analysis of the Avastroviridae whole genome and ORF2 capsid polyprotein classified the first complete whole genome of ANV-3 within Avastroviridae genogroup 2.
| S-EPMC7913312 | biostudies-literature
Project description:A new strain of avian picornavirus was identified in fecal samples from broiler chickens in a commercial farm in the municipality of Benevides, Pará, Brazil. Genomic analysis showed it to have a nucleotide identity of 78.4% with the family Picornaviridae, genus Avisivirus, and species Avisivirus A, suggesting that this is a possible new strain within this species.
| S-EPMC5864945 | biostudies-literature
Project description:Gamma (γ)-radiation can target viral genome replication and preserve viral structural proteins compared to formalin inactivation. Thus, a stronger immunity could be induced after the inoculation of the irradiated virus. In this study, γ-irradiated low-pathogenic avian influenza virus-H9N2 (LPAIV-H9N2) was used to immunize the broiler chicken in two formulations, including γ-irradiated LPAIV-H9N2 with 20% Trehalose intranasally (IVT.IN) or γ-irradiated LPAIV-H9N2 plus Montanide oil adjuvant ISA70 subcutaneously (IV+ISA.SC) in comparison with formalin-inactivated LPAIV-H9N2 vaccine intranasally (FV.IN) or formalin-inactivated LPAIV-H9N2 plus ISA70 subcutaneously (FV+ISA.SC). Two vaccination regimes were employed; the first one was primed on day 1 and boosted on day 15 (early regime), and the second one was primed on day 11 and boosted on day 25 (late regime). A challenge test was performed with a live homologous subtype virus. Virus shedding was monitored by quantifying the viral load via RT-qPCR on tracheal and cloacal swabs. Hemagglutination inhibition (HI) antibody titration and stimulation index (SI) of the splenic lymphocyte proliferation were measured, respectively, by HI test and Cell Proliferation assay. Cytokine assay was conducted by the RT-qPCR on antigen-stimulated spleen cells. The results of the HI test showed significant increases in antibody titer in all vaccinated groups, but it was more evident in the IVT late vaccination regime, reaching 5.33 log2. The proliferation of stimulated spleen lymphocytes was upregulated more in the IVT.IN vaccine compared to other vaccines. The mRNA transcription levels of T-helper type 1 cytokines such as interferon-gamma (IFN-γ) and interleukin 2 (IL-2) were upregulated in all vaccinated groups at the late regime. Moreover, IL-6, a pro-inflammatory cytokine was upregulated as well. However, upregulation was more noticeable in the early vaccination than the late vaccination (p< 0.05). After the challenge, the monitoring of virus shedding for the H9 gene represented an extremely low viral load. The body weight loss was not significant (p > 0.05) among the vaccinated groups. In addition, the viral load of <100.5 TCID50/ml in the vaccinated chicken indicated the protective response for all the vaccines. Accordingly, the IVT vaccine is a good candidate for the immunization of broiler chicken via the intranasal route at late regime.
| S-EPMC9315219 | biostudies-literature
Project description:Avian leukosis virus (ALV) belongs to the family Retroviridae and causes considerable economic losses to the poultry industry. Following an outbreak associated with high mortality in a broiler flock in northern part of Malaysia, kidney tissues from affected chickens were submitted for virus isolation and identification in chicken embryonated egg and MDCK cells. Evidence of virus growth was indicated by haemorrhage and embryo mortality in egg culture. While viral growth in cell culture was evidenced by the development of cytopathic effects. The isolated virus was purified by sucrose gradient and identified using negative staining transmission electron microscopy. Further confirmation was achieved through next-generation sequencing and nucleotide sequence homology search. Analysis of the viral sequences using the NCBI BLAST tool revealed 99-100% sequence homology with exogenous ALV viral envelope protein. Phylogenetic analysis based on partial envelope sequences showed the Malaysian isolate clustered with Taiwanese and Japanese ALV strains, which were closer to ALV subgroup J, ALV subgroup E, and recombinant A/E isolates. Based on these findings, ALV was concluded to be associated with the present outbreak. It was recommended that further studies should be conducted on the molecular epidemiology and pathogenicity of the identified virus isolate.
| S-EPMC5002465 | biostudies-literature
Project description:BACKGROUND: Chicken anemia virus (CAV) is the causative agent of chicken infectious anemia (CIA). Study on the type of CAV isolates present and their genetic diversity, transmission to their progeny and level of protection afforded in the breeder farms is lacking in Malaysia. Hence, the present study was aimed to detect CAV from commercial broiler breeder farms and characterize CAV positive samples based on sequence and phylogenetic analysis of partial VP1 gene. RESULTS: A total of 12 CAV isolates from different commercial broiler breeder farms were isolated and characterized. Detection of CAV positive embryos by the PCR assay in the range of 40 to 100% for different farms indicated high level of occurrence of vertical transmission of viral DNA to the progeny. CAV antigen was detected in the thymus and in the bone marrow but not in spleen, liver, duodenum, ovary and oviduct by indirect immunoperoxidase staining. The 12 CAV isolates were characterized based on partial sequences of VP1 gene. Six isolates (MF1A, MF3C, M3B5, NF4A, P12B and P24A) were found to have maximum homology with previously characterized Malaysian isolate SMSC-1, four isolates (M1B1, NF3A, PYT4 and PPW4) with isolate BL-5 and the remaining two (NF1D and NF2C) have maximum homology both with isolates 3-1 and BL-5. Meanwhile, seven of the isolates with amino acid profile of 75-I, 97-L, 139-Q and 144-Q were clustered together in cluster I together with other isolates from different geographical places. The remaining five isolates with amino acid profile of 75-V, 97-M, 139-K and 144-E were grouped under cluster II. All the CAV isolates demonstrated omega values (Ka/Ks) of less than one (the values ranging from 0.07 to 0.5) suggesting the occurrence of purifying (negative) selection in all the studied isolates. CONCLUSION: The present study showed that CAV is widespread in the studied commercial broiler breeder farms. The result also indicated the occurrence of genetic variability in local CAV isolates that can be divided at least into two groups based on characteristic amino acid substitutions at positions 75, 97, 139 and 144 of the VP1 protein.
| S-EPMC2605446 | biostudies-literature
Project description:To determine the host response to AIV in chicken lungs, a whole chicken genome array was used to analyze RNA isolated from chicken lungs infected with AIV (4dpi) or medium control (NS). Dual-color, direct comparisons were carried between AIV infected and non-infected controls. Each comparison includes four biological replicates. There were 508 mRNAs (347 down-regulated) were differentially expressed following AIV infection. From the results, MX1, IL-8, IRF-7, TNFRS19 are identified as strong candidate genes involved in regulating the host response to AIV infection in the lungs of broiler chickens. Further gene specific knock-down assay is warranted to elucidate underlying mechanism of AIV infection regulation in the chicken.
2012-06-07 | GSE38197 | GEO
Project description:chicken gut metagenome breed:Avian broiler Raw sequence reads
| PRJNA573420 | ENA
Project description:To determine the host response to AIV in chicken lungs, a whole chicken genome array was used to analyze RNA isolated from chicken lungs infected with AIV (4dpi) or medium control (NS). Dual-color, direct comparisons were carried between AIV infected and non-infected controls. Each comparison includes four biological replicates. There were 508 mRNAs (347 down-regulated) were differentially expressed following AIV infection. From the results, MX1, IL-8, IRF-7, TNFRS19 are identified as strong candidate genes involved in regulating the host response to AIV infection in the lungs of broiler chickens. Further gene specific knock-down assay is warranted to elucidate underlying mechanism of AIV infection regulation in the chicken. Dual-color, common reference comparisons were carried between AIV infected and non-infected controls. Four biological replicates, with dye swap labeling, were included in the comparisons. Background subtracted signal intensity were collected from 4 arrays and normalized before data analysis.
2012-06-06 | E-GEOD-38197 | biostudies-arrayexpress
Project description:One IBV isolate, SC021202, was isolated from the kidneys of the infected young chickens by inoculating embryonated eggs, and its morphology, physiochemical and haemagglutonating properties were detected. Virulence of the isolate SC021202 was determined with specific pathogen-free (SPF) chicken inoculation. Nucleotide acid sequence of S1 gene of the isolate SC021202 was further sequenced and analysed. The physiochemical and morphological properties of the isolate SC021202 were in accordance to that of typical infectious bronchitis virus (IBV). In a pathogenicity experiment, the clinical signs and related gross lesions resembling those of field outbreak were reproduced and the virus isolate SC021202 was re-isolated from the kidneys of the infected chicken. Sequence data demonstrated that the full length of the amplified S1 gene of the isolate SC021202 was composed of 1931 nucleotides, coding a polypeptide of 543 amino acid residues. Compared with IBV strains from GenBank, the nucleotide and deduced amino acid sequence of S1 gene of the isolate SC021202 shared 60.0-91.4% and 49.1-88.9% identities, respectively. A nucleotide fragment of 'CTTTTTAATTATACTAACGGA' was inserted at nucleotide site 208 in the S1 gene of the isolate. These results indicated that IBV isolate SC021202 was a new variant IBV isolate and responsible for field outbreak of nephritis.
| S-EPMC7165564 | biostudies-literature