Browse
Submit Data
Databases
API
Help

Dataset Information

21 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

First Isolation and Molecular Characterization of Chicken Astrovirus and Avian Nephritis Virus in Chickens in Bangladesh.

ABSTRACT: Chicken astrovirus (CAstV) and avian nephritis virus (ANV) are enteric viruses of poultry and have infected a wide range of poultry species worldwide, causing runting-stunting syndrome (RSS), which requires virus screening and results in serious economic damage. No confirmed cases have been reported from Bangladesh. In the present study, CAstV and ANV were monitored in Bangladesh. We monitored samples for CAstV and ANV and compared their genomic sequences to other reference strains. We found 8/31 flocks (25.8%) were positive for CAstV, 6/31 flocks (19.3%) had mixed infection of CAstV and ANV, and 1 flock (3.2%) was positive for ANV. Only ANV and a combination of CAstV and ANV were found in broilers and broiler breeders, but CAstV was found in all types of chickens. We isolated two of each from CAstV and ANV through specific pathogen-free chicken embryonated eggs via the yolk sac route. Phylogenetic analysis based on the ORF1b conserved region of CAstV and ANV suggested that the locally circulating strain was closely related to the strains isolated from India and Brazil. This report is the first molecular characterization of CAstV and ANV in Bangladesh. This study highlights that CAstV and ANV are circulating in Bangladeshi poultry.

SUBMITTER: Ali MZ

PROVIDER: S-EPMC8672296 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Isolation of avian nephritis virus from chickens showing enteric disorders.

Project description:Runting-stunting syndrome (RSS) is one of the diseases associated with many detected viruses. In Brazil, there were reports of several enteric disease outbreaks in chickens in which avian nephritis virus (ANV) was detected; however, the role of ANV in the outbreaks and whether the virus was a causative agent of these cases of enteric diseases were not determined. The aim of this study was to isolate ANV in specific pathogen-free (SPF) chicken embryonated eggs (CEE) from the enteric contents of chickens showing signs of RSS. For this purpose, 22 samples of chicken enteric contents that were positive only for ANV were inoculated into 7 and 14-day-old SPF-CEE via the yolk sac route and incubated for 5 d, with a total of 3 passages. Virus isolation was confirmed by the presence of embryo injuries, detection of viral RNA by RT-PCR, and visualization of viral particles using electron microscopy. Therefore, the 7-day-old inoculated embryos showed dwarfism, gelatinous consistency, hemorrhage, and edema in the embryos, whereas the 14-day-old did not show any alteration. Viral RNA was detected in the embryos of both ages of inoculation, and the same viral particles were visualized. The embryos from the mock group showed no alteration and were negative for all the tests. The viral cDNA was sequenced, and the molecular and phylogenetic analyses showed that the Brazilian isolates are more related with the ANV-1 serotype group; the sequences of these isolates showed a high percentage of nucleotide (86.4 to 94.9%) and amino acid (92.3 to 98.7%) similarity with other sequences from China, Japan, Australia, and the United States that belong to this serotype previously classified group. In this study, we isolated 8 samples of ANV in SPF-CEE from enteric content samples from chickens with RSS. In doing so, we showed the pathological injuries to the embryo caused by the virus and the molecular characterization of a part of the ORF 1b gene of the virus.

| S-EPMC6142861 | biostudies-literature

First Whole-Genome Characterization of Avian Nephritis Virus 2 of Broiler Chicken from Para, Brazil.

Project description:Our results show the first full-genome characterization of avian nephritis virus 2 recovered from stools of broiler chickens at a commercial farm located in Benevides, Pará, Brazil. Nucleotide analyses of whole-genome sequences showed the isolate to be a strain of Avastrovirus 2 in the family Astroviridae.

| S-EPMC6013626 | biostudies-literature

Characterization of an avian infectious bronchitis virus isolated in China from chickens with nephritis.

Project description:One IBV isolate, SC021202, was isolated from the kidneys of the infected young chickens by inoculating embryonated eggs, and its morphology, physiochemical and haemagglutonating properties were detected. Virulence of the isolate SC021202 was determined with specific pathogen-free (SPF) chicken inoculation. Nucleotide acid sequence of S1 gene of the isolate SC021202 was further sequenced and analysed. The physiochemical and morphological properties of the isolate SC021202 were in accordance to that of typical infectious bronchitis virus (IBV). In a pathogenicity experiment, the clinical signs and related gross lesions resembling those of field outbreak were reproduced and the virus isolate SC021202 was re-isolated from the kidneys of the infected chicken. Sequence data demonstrated that the full length of the amplified S1 gene of the isolate SC021202 was composed of 1931 nucleotides, coding a polypeptide of 543 amino acid residues. Compared with IBV strains from GenBank, the nucleotide and deduced amino acid sequence of S1 gene of the isolate SC021202 shared 60.0-91.4% and 49.1-88.9% identities, respectively. A nucleotide fragment of 'CTTTTTAATTATACTAACGGA' was inserted at nucleotide site 208 in the S1 gene of the isolate. These results indicated that IBV isolate SC021202 was a new variant IBV isolate and responsible for field outbreak of nephritis.

| S-EPMC7165564 | biostudies-literature

Isolation and characterization of a novel chicken astrovirus in China.

Project description:Chicken astrovirus (CAstV) is associated with kidney disease and visceral gout, runting and stunting syndrome, and white chick hatchery disease, causing economic losses to the poultry industry worldwide. In this study, 55.6% of 36 clinical samples from Guangdong province in China were positive for CAstV, but negative for other common enteric viruses, including avian nephritis virus, infectious bronchitis virus, fowl adenovirus Group I, Newcastle disease virus, chicken parvovirus, reovirus, and rotavirus by PCRs and RT-PCRs. A CAstV strain, named GD202013, was isolated from Guangdong province in south China, and was identified by CAstV RT-PCR. A whole genome sequence analysis demonstrated that GD202013 shares 76.0 to 88.1% identity with 24 reference strains in GenBank. Phylogenetic analysis, based on whole genome and capsid protein, showed that GD202013 is more closely related to 2 US strains (GA2011/US/2011 and 4175/US/2011) belonging to subgroup Bii. Recombination analysis indicated that GD202013 is a recombinant strain formed by 3 strains: a major parent strain CkP5/US/2016, and 2 minor parent strains (GA2011/US/2011 and G059/PL/2014). In addition, the chicken embryo infection experiment demonstrated that GD202013 causes hatchability reduction, growth depression, and death of embryos. Macroscopic and microscopic lesions in the liver, kidney and small intestine were observed in the dead-in-shell embryos. This is the first report of the novel CAstV infection in China.

| S-EPMC8350400 | biostudies-literature

The Isolation and Molecular Characterization of an Astrovirus From "Yellow" Chickens, China.

Project description:Chicken astrovirus (CAstV) infection is strongly associated with kidney disease, gout, "white chicks" hatchery disease, and runting and stunting syndrome (RSS). In the present study, 82.5% of 154 clinical samples from different provinces in China were positive for CAstV by RT-PCR. One CAstV isolate, designated as AAstV/Chicken/CHN/2017/NJ01, was successfully isolated from the small intestine of "Yellow" chickens using LMH cells. The genome sequence and structure analyses revealed that NJ1701 had the typical characteristics of avian astroviruses which was genetically distinct from other Avastrovirus. This isolate was classified as Group B subgroup i based on phylogenetic analysis of complete ORF2 (capsid) amino acid sequences. Meanwhile, growth depression and hatchability reduction were observed in the chicken embryo infection experiment. The results in the current study will contribute to our understanding of chicken astrovirus in China.

| S-EPMC7655128 | biostudies-literature

Isolation and characterization of avian metapneumovirus from chickens in Korea.

Project description:Avian metapneumovirus (aMPV) causes upper respiratory tract infections in chickens and turkeys. Although the swollen head syndrome (SHS) associated with aMPV in chickens has been reported in Korea since 1992, this is the study isolating aMPV from chickens in this country. We examined 780 oropharyngeal swab or nasal turbinate samples collected from 130 chicken flocks to investigate the prevalence of aMPV and to isolate aMPV from chickens from 2004-2008. Twelve aMPV subtype A and 13 subtype B strains were detected from clinical samples by the aMPV subtype A and B multiplex real-time reverse transcription polymerase chain reaction (RRT-PCR). Partial sequence analysis of the G glycoprotein gene confirmed that the detected aMPVs belonged to subtypes A and B. Two aMPVs subtype A out of the 25 detected aMPVs were isolated by Vero cell passage. In animal experiments with an aMPV isolate, viral RNA was detected in nasal discharge, although no clinical signs of SHS were observed in chickens. In contrast to chickens, turkeys showed severe nasal discharge and a relatively higher titer of viral excretion than chickens. Here, we reveal the co-circulation of aMPV subtypes A and B, and isolate aMPVs from chicken flocks in Korea.

| S-EPMC2833431 | biostudies-literature

Molecular characterization of an avian astrovirus.

Project description:Astroviruses are known to cause enteric disease in several animal species, including turkeys. However, only human astroviruses have been well characterized at the nucleotide level. Herein we report the nucleotide sequence, genomic organization, and predicted amino acid sequence of a turkey astrovirus isolated from poults with an emerging enteric disease.

| S-EPMC112117 | biostudies-literature

The First Whole Genome Sequence and Characterisation of Avian Nephritis Virus Genotype 3.

Project description:Avian nephritis virus (ANV) is classified in the Avastroviridae family with disease associations with nephritis, uneven flock growth and runting stunting syndrome (RSS) in chicken and turkey flocks, and other avian species. The whole genome of ANV genotype 3 (ANV-3) of 6959 nucleotides including the untranslated 5' and 3' regions and polyadenylated tail was detected in a metagenomic virome investigation of RSS-affected chicken broiler flocks. This report characterises the ANV-3 genome, identifying partially overlapping open reading frames (ORFs), ORF1a and ORF1b, and an opposing secondary pseudoknot prior to a ribosomal frameshift stemloop structure, with a separate ORF2, whilst observing conserved astrovirus motifs. Phylogenetic analysis of the Avastroviridae whole genome and ORF2 capsid polyprotein classified the first complete whole genome of ANV-3 within Avastroviridae genogroup 2.

| S-EPMC7913312 | biostudies-literature

Isolation and pathogenicity testing of avian reticuloendotheliosis virus from layer chickens in China.

Project description:Reticuloendotheliosis virus (REV) can cause runting, immunosuppression, acute reticulum cell neoplasia, and chronic lymphoid tumors in a variety of domestic and wild birds. We diagnosed a case of reticuloendotheliosis with obvious tumors in liver and kidney. We isolated and sequenced the virus and performed pathogenicity testing of the REV strain. Immunohistochemistry and PCR confirmed that the diseased layer chickens were infected with REV. The strain, named BJ1503, was successfully isolated from the case by inoculation of tissue homogenates onto chicken embryo fibroblasts. The length of the proviral REV genome is 8,293 nucleotides. The isolate had 99.7% identity with REV-HA9901 (AY842951.1), which was isolated from Jiangsu, China, in 1999. The chickens infected with REV-BJ1503 had depressed weight gain and lymphoid atrophy. Our findings suggest that REV isolate BJ1503 was phylogenetically close to the earlier strain found in China, with minor variations, and the virus was associated with severe production problems.

| S-EPMC7377614 | biostudies-literature

Gene expression profile of chicken lung in response to Avian influenza virus challenge in broiler chickens

Project description:To determine the host response to AIV in chicken lungs, a whole chicken genome array was used to analyze RNA isolated from chicken lungs infected with AIV (4dpi) or medium control (NS). Dual-color, direct comparisons were carried between AIV infected and non-infected controls. Each comparison includes four biological replicates. There were 508 mRNAs (347 down-regulated) were differentially expressed following AIV infection. From the results, MX1, IL-8, IRF-7, TNFRS19 are identified as strong candidate genes involved in regulating the host response to AIV infection in the lungs of broiler chickens. Further gene specific knock-down assay is warranted to elucidate underlying mechanism of AIV infection regulation in the chicken.

2012-06-07 | GSE38197 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data