Browse
Submit Data
Databases
API
Help

Dataset Information

19 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Grapevine virus T diversity as revealed by full-length genome sequences assembled from high-throughput sequence data.

ABSTRACT: RNASeq or double-stranded RNA based approaches allowed the reconstruction of a total of 9 full-length or near full-length genomes of the recently discovered grapevine virus T (GVT). In addition, datamining of publicly available grapevine RNASeq transcriptome data allowed the reconstruction of a further 14 GVT genomes from five grapevine sources. Together with four GVT sequences available in Genbank, these novel sequences were used to analyse GVT diversity. GVT shows a very limited amount of indels variation but a high level of nucleotide and aminoacid polymorphism. This level is comparable to that shown in the closely related grapevine rupestris stem pitting-associated virus (GRSPaV). Further analyses showed that GVT mostly evolves under conservative selection pressure and that recombination has contributed to its evolutionary history. Phylogenetic analyses allow to identify at least seven clearly separated groups of GVT isolates. Analysis of the only reported PCR GVT-specific detection primer pair indicates that it is likely to fail to amplify some GVT isolates. Taken together these results point at the distinctiveness of GVT but also at the many points it shares with GRSPaV. They constitute the first pan-genomic analysis of the diversity of this novel virus.

SUBMITTER: Nourinejhad Zarghani S

PROVIDER: S-EPMC6207325 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

WebPrInSeS: automated full-length clone sequence identification and verification using high-throughput sequencing data.

Project description:High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users.

| S-EPMC2896179 | biostudies-literature

Baiting out a full length sequence from unmapped RNA-seq data

Project description:Usually, unmapped reads have been considered as useless and been trashed or ignored. Here, we develop a strategy to mining the full length sequence by unmapped reads combining with specific reverse transcription primers design and high throughput sequencing. In this study, we salvage 36 unmapped reads from standard RNA-Seq data(GSM3188619) and randomly select one 149 bp read as a model(CTGGTGCCATAATTCAGGGAACTGTGTTCTTGATGTACTATCTGAGACATTTGTGCTTCCCCCCATCCAGCTATCAGGCTGTTAGGCAATGCACTTCTAGGAATTAGAATTCTATAAGGAATCTCATGCTGGAAGAACAAAAAGACCCA ). Specific reverse transcription primers(5' end:CTGGTGCCATAATTCAGGGA, 3' end:GGATCTTCACGTAACGGATTGT) are designed to amplify its both ends, followed by next generation sequencing. Then we use a statistical model base on power law distribution to estimate its integrality and significance. Further, we validate it by Sanger sequencing. The result shows that the full length is 1,556 bp, with InDel mutation in microsatellite structure. This would be a useful strategy to extract the sequences information from the unmapped RNA-seq data.

2021-04-22 | GSE172487 | GEO

Baiting out a full length sequence from unmapped RNA-seq data.

Project description:BackgroundAs a powerful tool, RNA-Seq has been widely used in various studies. Usually, unmapped RNA-seq reads have been considered as useless and been trashed or ignored.ResultsWe develop a strategy to mining the full length sequence by unmapped reads combining with specific reverse transcription primers design and high throughput sequencing. In this study, we salvage 36 unmapped reads from standard RNA-Seq data and randomly select one 149 bp read as a model. Specific reverse transcription primers are designed to amplify its both ends, followed by next generation sequencing. Then we design a statistical model based on power law distribution to estimate its integrality and significance. Further, we validate it by Sanger sequencing. The result shows that the full length is 1556 bp, with insertion mutations in microsatellite structure.ConclusionWe believe this method would be a useful strategy to extract the sequences information from the unmapped RNA-seq data. Further, it is an alternative way to get the full length sequence of unknown cDNA.

| S-EPMC8626966 | biostudies-literature

High molecular diversity of full-length genome sequences of zucchini yellow fleck virus from Europe.

Project description:Zucchini yellow fleck virus (ZYFV), genus Potyvirus, is the causal agent of a disease of cucurbits. The genome sequences of seven ZYFV isolates of different origin were determined, two of which were reconstructed from a squash (Cucurbita sp.) collected in 2017 in Greece, while the others, accessions from the DSMZ Plant Virus Collection, were from samples collected in Italy, Greece, and France in the 1980s and 1990s. A high level of molecular diversity, well dispersed along the genome, was observed, but this was within the limits for assignment of the virus isolates to the same species. P1 was the most diverse gene, and isolates from squash contained an insertion in this gene.

| S-EPMC9556397 | biostudies-literature

Full-length HLA class II sequences

Project description:Full-length HLA class II sequences

| PRJEB42469 | ENA

Full-length minor ampullate spidroin gene sequence.

Project description:Spider silk includes seven protein based fibers and glue-like substances produced by glands in the spider's abdomen. Minor ampullate silk is used to make the auxiliary spiral of the orb-web and also for wrapping prey, has a high tensile strength and does not supercontract in water. So far, only partial cDNA sequences have been obtained for minor ampullate spidroins (MiSps). Here we describe the first MiSp full-length gene sequence from the spider species Araneus ventricosus, using a multidimensional PCR approach. Comparative analysis of the sequence reveals regulatory elements, as well as unique spidroin gene and protein architecture including the presence of an unusually large intron. The spliced full-length transcript of MiSp gene is 5440 bp in size and encodes 1766 amino acid residues organized into conserved nonrepetitive N- and C-terminal domains and a central predominantly repetitive region composed of four units that are iterated in a non regular manner. The repeats are more conserved within A. ventricosus MiSp than compared to repeats from homologous proteins, and are interrupted by two nonrepetitive spacer regions, which have 100% identity even at the nucleotide level.

| S-EPMC3522626 | biostudies-literature

Full-length genome sequence of Ntaya virus.

Project description:Presentation of pyrosequencing data and phylogenetic analysis for the full genome of Ntaya virus, type virus of the Ntaya virus group of the Flaviviridae isolated in Cameroon in 1966.

| S-EPMC3556468 | biostudies-literature

Full-length messenger RNA sequences greatly improve genome annotation.

Project description:BackgroundAnnotation of eukaryotic genomes is a complex endeavor that requires the integration of evidence from multiple, often contradictory, sources. With the ever-increasing amount of genome sequence data now available, methods for accurate identification of large numbers of genes have become urgently needed. In an effort to create a set of very high-quality gene models, we used the sequence of 5,000 full-length gene transcripts from Arabidopsis to re-annotate its genome. We have mapped these transcripts to their exact chromosomal locations and, using alignment programs, have created gene models that provide a reference set for this organism.ResultsApproximately 35% of the transcripts indicated that previously annotated genes needed modification, and 5% of the transcripts represented newly discovered genes. We also discovered that multiple transcription initiation sites appear to be much more common than previously known, and we report numerous cases of alternative mRNA splicing. We include a comparison of different alignment software and an analysis of how the transcript data improved the previously published annotation.ConclusionsOur results demonstrate that sequencing of large numbers of full-length transcripts followed by computational mapping greatly improves identification of the complete exon structures of eukaryotic genes. In addition, we are able to find numerous introns in the untranslated regions of the genes.

| S-EPMC116726 | biostudies-literature

High-Throughput Chemical Probing of Full-Length Protein-Protein Interactions.

Project description:Human biology is regulated by a complex network of protein-protein interactions (PPIs), and disruption of this network has been implicated in many diseases. However, the targeting of PPIs remains a challenging area for chemical probe and drug discovery. Although many methodologies have been put forth to facilitate these efforts, new technologies are still needed. Current biochemical assays for PPIs are typically limited to motif-domain and domain-domain interactions, and assays that will enable the screening of full-length protein systems, which are more biologically relevant, are sparse. To overcome this barrier, we have developed a new assay technology, "PPI catalytic enzyme-linked click chemistry assay" or PPI cat-ELCCA, which utilizes click chemistry to afford catalytic signal amplification. To validate this approach, we have applied PPI cat-ELCCA to the eIF4E-4E-BP1 and eIF4E-eIF4G PPIs, key regulators of cap-dependent mRNA translation. Using these examples, we have demonstrated that PPI cat-ELCCA is amenable to full-length proteins, large (>200 kDa) and small (?12 kDa), and is readily adaptable to automated high-throughput screening. Thus, PPI cat-ELCCA represents a powerful new tool in the toolbox of assays available to scientists interested in the targeting of disease-relevant PPIs.

| S-EPMC5939945 | biostudies-literature

Reconstruction of Full-Length circRNA Sequences Using Chimeric Alignment Information.

Project description:Circular RNAs (circRNAs) are RNA molecules formed by joining a downstream 3 splice donor site and an upstream 5 splice acceptor site. Several recent studies have identified circRNAs as potential biomarker for different diseases. A number of methods are available for the identification of circRNAs. The circRNA identification methods cannot provide full-length sequences. Reconstruction of the full-length sequences is crucial for the downstream analyses of circRNA research including differential expression analysis, circRNA-miRNA interaction analysis and other functional studies of the circRNAs. However, a limited number of methods are available in the literature for the reconstruction of full-length circRNA sequences. We developed a new method, circRNA-full, for full-length circRNA sequence reconstruction utilizing chimeric alignment information from the STAR aligner. To evaluate our method, we used full-length circRNA sequences produced by isocirc and ciri-long using long-reads RNA-seq data. Our method achieved better reconstruction rate, precision, sensitivity and F1 score than the existing full-length circRNA sequence reconstruction tool ciri-full for both human and mouse data.

| S-EPMC9223815 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data