Baiting out a full length sequence from unmapped RNA-seq data
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
PROVIDER: GSE172487 | GEO | 2021/04/22
REPOSITORIES: GEO
Similar Datasets
Project description:The 3' ends of most Drosophila melanogaster genes are poorly annotated or are determined by only a single EST or cDNA clone. To enhance the annotation of poly(A) site use in Drosophila, we performed deep sequencing on RNA isolated from 29 dissected tissues using an approach designed to enrich for poly(A) spanning reads. From these experiments, we identified 1.4 million poly(A) spanning reads leading to the identification of many new poly(A) sites and the identification of many tissue-specific poly(A) sites. For data usage terms and conditions, please refer to http://www.genome.gov/27528022 and http://www.genome.gov/Pages/Research/ENCODE/ENCODEDataReleasePolicyFinal2008.pdf RNA from 29 dissected Drosophila melanogaster tissues (in duplicate) were used to prepare polyA enriched RNA-Seq libraries. Briefly, total RNA was poly(A) selected, fragmented, and ligated to 5' and 3' RNA linkers. These libraries were amplified using Illumina paired-end primers, and subsequently reamplified using a 3' primer complementary to the 3' adapter but containing 6 Ts at the 3' end. The libraries were also multiplexed and up to 12 samples mixed per lane and sequenced on an Illumina GAIIx using paired-end 76 bp reads, or an illumina HiSeq 2000 using paired-end 100 bp reads. All reads were mapped to the Drosophila melanogaster genome to identify unmapped reads. Unmapped reads containing at least 10 A residues at the 3' end were identified, the terminal A residues trimmed, realigned to the genome to identify uniquely mapped reads. Such reads were identified as polyA spanning reads
2011-11-23 | E-GEOD-33905 | biostudies-arrayexpress
Project description:mRNAs of siCTRL, siNSUN2 and ALYREF-RIP HeLa cells, and multiple mouse tissues were purified using oligo (dT)-conjugated magnetic beads followed by RiboMinus treatement. mRNAs were fragmented to ~200 nt and treated by Sodium bisulfite solution (pH 5.1) containing Hydroquinone. Bisulfite treated mRNAs were reverse transcribed to cDNA using ACT random hexamer primers. The cDNAs were subjected to libraries construction using KAPA Stranded mRNA-Seq Kit (KAPA) and performed sequencing on HiSeq2500 (Illumina) in pair-end mode, creating reads with a length of 125 bp. Sequencing chemistry v4 (Illumina) was used and every sample was sequenced at one lane.
2017-04-19 | GSE93749 | GEO
Project description:mRNAs of human and mouse cell lines were purified using oligo (dT)-conjugated magnetic beads followed by RiboMinus treatement. mRNAs were fragmented to ~100 nt and treated by Sodium bisulfite solution (pH 5.1) containing Hydroquinone. Bisulfite treated mRNAs were reverse transcribed to cDNA using ACT random hexamer primers. The cDNAs were subjected to libraries construction using KAPA Stranded mRNA-Seq Kit (KAPA) and performed sequencing on HiSeq2000/3000 (Illumina) in pair-end mode, creating reads with a length of 101 bp. Sequencing chemistry v2 (Illumina) was used and samples were multiplexed in two samples per lane.
2018-10-23 | GSE74771 | GEO
Project description:This data was generated by ENCODE. If you have questions about the data, contact the submitting laboratory directly (Yijun Ruan mailto:ruanyj@gis.a-star.edu.sg). If you have questions about the Genome Browser track associated with this data, contact ENCODE (mailto:genome@soe.ucsc.edu). This track is produced as part of the ENCODE Transcriptome Project. It shows the starts and ends of full length mRNA transcripts determined by GIS paired-end ditag (PET) sequencing using RNA extracts (http://hgwdev.cse.ucsc.edu/cgi-bin/hgEncodeVocab?type=rnaExtract) from different sub-cellular localizations (http://hgwdev.cse.ucsc.edu/cgi-bin/hgEncodeVocab?type=localization) in different cell lines (http://hgwdev.cse.ucsc.edu/cgi-bin/hgEncodeVocab?type=cellType). The RNA-PET information provided in this track is composed of two different PET length versions based on how the PETs were extracted. The cloning-based PET (18 bp and 16 bp) is an earlier version and detailed information can be found from reference (Ng et al. 2006). The cloning-free PET (25 bp and 25 bp) is a recently modified version which uses Type II enzyme EcoP15I to generate a longer length of PET (unpublished), which results in a significant enhancement in both library construction and mapping efficiency. Both versions of PET templates were sequenced by Illumina platform at 2 x 36 bp Paired End sequencing. See the Methods and References sections below for more details. For data usage terms and conditions, please refer to http://www.genome.gov/27528022 and http://www.genome.gov/Pages/Research/ENCODE/ENCODEDataReleasePolicyFinal2008.pdf Cells were grown according to the approved ENCODE cell culture protocols (http://hgwdev.cse.ucsc.edu/ENCODE/protocols/cell). Two different GIS RNA-PET protocols were used to generate the full length transcriptome PETs: one is based on a cloning-free RNA-PET library construction and sequencing strategy (unpublished), and the other is a cloning-based library construction (Ng et al. 2005) and recent Illumina paired end sequencing. Cloning-free RNA-PET (50 bp reads, 25 bp and 25 bp tag for each of the 5' and 3' ends)--Method: The cloning-free RNA-PET libraries were generated from polyA mRNA samples and constructed using a recently modified GIS protocol (unpublished). Total RNA in good quality was used as starting material and purified through MACs polyT column to obtain full length polyA mRNAs. Approximately 5 micrograms of enriched polyA mRNA were used for reverse transcription to convert polyA mRNA to full length cDNA. The obtained full length cDNA was modified and ligated with specific linker sequences, followed by circularization through ligation to generate circular cDNA molecules. The 25 bp tag from each end of the full length cDNA was extracted by type II enzyme EcoP15I digestion. The resulting PETs were ligated with sequencing adaptors at the both ends, amplified by PCR, and further purified as complex templates for paired end (PE) sequencing using Illumina platforms. Data: The sequenced RNA-PETs are unified in 25/25 bp length from each end of a cDNA. After filtering out redundant and noise tags, the unique PETs will proceed to analysis pipeline. Initially, the orientation of each tag will be screened out by the barcode built in the sequencing-template, then paired into a given orientation-PET. The orientation-determined RNA-PET is mapped onto reference genome allowing up to two mismatches. Majority of PETs are mapped on the known transcripts, or splice variants. A small portion of misaligned PETs, defined as discordant PETs, are mapped either too far from each tag, have wrong orientations, or mapped in different chromosomes, indicating exist some transcription variations which could be caused by genome structure variations: such as fusion, deletion, insertion, inversion, tandem repeat and translocation; or RNA trans-splicing etc. Cloning-based RNA-PET (34 bp reads, 18 bp and 16 bp tag for each of the 5' and 3' ends)--Method: The cloning-based RNA-PET (GIS-PET) libraries were generated from polyA RNA samples and constructed using the protocol described by Ng et al. (2005). Total RNA in good quality was used as starting material and further purified through MACs polyT column to enrich polyA mRNA and remove any contaminants (e.g., rRNA, tRNA, DNA, protein etc). Approximately 10 micrograms of polyA mRNA were then used for reverse transcription to convert polyA mRNA into full length cDNA. The obtained full length cDNA was modified with specific linker sequences, then, ligated to a GIS-developed (pGIS4) vector to form a complex full length cDNA library, which was cloned into E. coli. The plasmid DNA was then isolated from the library, followed by MmeI (a type II enzyme) digestion to generate a final length of 18 bp/16 bp ditags from each end of the full length cDNA. The single ditag (or called PET) was then ligated to form a diPET structure (a concatemer with two unrelated PET linked by a linker sequence) to facilitate Illuminaa Paired End sequencing. Data: The cloning-based RNA-PETs are unified in 18 bp and 16 bp length, respectively extracted from 5' and 3' end of each cDNA. The redundant reads were filtered out initially and unique ones were included for analysis. PET sequences were then mapped to (GRCh37, hg19, excluding mitochondirion, haplotypes, randoms and chromosome Y) reference genome using the following specific criteria (Ruan et al. 2007): A minimal continuous 16 bp match must exist for the 5' signature; the 3' signature must have a minimal continuous 14 bp match. Both 5' and 3' signatures must be present on the same chromosome. Their 5' to 3' orientation must be correct (5' signature followed by 3' signature). The maximal genomic span of a PET genomic alignment must be less than one million bp. PETs mapping to 2-10 locations are also included and may represent duplicated genes or pseudogenes in the genome. A majority of PETs mapped on the known transcripts or splice variants. A small portion of misaligned PETs, defined as discordant PETs, were mapped either too far from each other, mapped in the wrong orientation, or mapped to different chromosomes, indicating that some transcription variations exist which could be caused by genome structure variations: such as fusion, deletion, insertion, inversion, tandem repeat and translocation; or RNA trans-splicing etc. Clusters: To cluster the PETs the following procedure was applied: the mapping location of the 5' and 3' tag of a given PET was extended by 100 bp in both directions creating 5' and 3' search windows. If the 5' and 3' tags of a second PET mapped within the 5' and 3' search window of the first PET then the two PETs were clustered and the search windows were adjusted so that they contained the tag extensions of the second PET. PETs which subsequently mapped with their 5' and 3' tags within the adjusted 5' and 3' search window, respectively, were also assigned to this cluster and search window readjusted. This iterative process continued till no new PET was found to fall within the search window, at which stage all the found PETs are classified as belonging to a single cluster. This process is repeated till all PETs are assigned to a cluster. Verification: To assess overall PET quality and mapping specificity, the top ten most abundant PET clusters that mapped to well-characterized known genes were examined. Over 99% of the PETs represented full-length transcripts, and the majority fell within 10 bp of the known 5' and 3' boundaries of these transcripts. The PET mapping was further verified by confirming the existence of physical cDNA clones represented by the ditags. PCR primers were designed based on the PET sequences and amplified the corresponding cDNA inserts either from full length cDNA library (cloning-based PET) or from total RNA isolate (cloning-free PET) for sequencing confirmation.
2011-11-10 | E-GEOD-33600 | biostudies-arrayexpress
Project description:To isolate Cx3cr1 fate mapped cells following lysolecithin-induced demyelination in the spinal cord, we performed stereotaxic injection of lysolecithin into the ventral white matter tract of the thoracic spinal cord in adult Cx3cr1-CreER:Rosa26-tdTomato+ve mice treated with tamoxifen 4 weeks previously. We FACS collected viable tdTomato+ve cells from uninjured mice and from mice at 5 days post-injury. All samples were processed according to 10X Genomics ChromiumTM Single Cell 3’ Reagent Guidelines v2 Chemistry as per the manufacturer’s protocol. In brief, single cells were sorted into 1% BSA–PBS and partitioned into Gel Bead-In-EMulsions (GEMs) using 10xTM GemCodeTM Technology. This process lysed cells and enabled barcoded reverse transcription of RNA, generating full-length cDNA from poly-adenylated mRNA. DynaBeads® MyOneTM Silane magnetic beads were used to remove leftover biochemical reagents, then cDNA was amplified by PCR. Quality control size gating was used to select cDNA amplicon size prior to library construction. Read 1 primer sequences were added to cDNA during GEM incubation. P5 primers, P7 primers, i7 sample index, and Read 2 primer sequences were added during library construction. Quality control and cDNA quantification was performed using Agilent High Sensitivity DNA Kit. Sequencing was performed first using Illumina MiSeq SR50 to approximate the number of recovered cells in each sample. We recovered 705 and 580 cells for Uninjured and Injured conditions, respectively. Based on this, we determined lane distributions for sequencing using Illumina HiSeq 4000 PE (75 bp paired-end reads) with a targeted sequencing depth of ~100,000-150,000 reads/cell.
2020-01-15 | GSE115803 | GEO
Project description:Background: Whole exome sequencing (WES) has been proven to serve as a valuable basis for various applications such as variant calling and copy number variation (CNV) analyses. For those analyses the read coverage should be optimally balanced throughout protein coding regions at sufficient read depth. Unfortunately, WES is known for its uneven coverage within coding regions due to GC-rich regions or off-target enrichment. Results: In order to examine the irregularities of WES within genes, we applied Agilent SureSelectXT exome capture on human samples and sequenced these via Illumina in 2x101 paired-end mode. As we suspected the sequenced insert length to be crucial in the uneven coverage of exome captured samples, we sheared 12 genomic DNA samples to two different DNA insert size lengths, namely 130 and 170 bp. Interestingly, although mean coverages of target regions were clearly higher in samples of 130 bp insert length, the level of evenness was more pronounced in 170 bp samples. Moreover, merging overlapping paired-end reads revealed a positive effect on evenness indicating overlapping reads as another reason for the unevenness. In addition, mutation analysis on a subset of the samples was performed. In these isogenic subclones almost twofold mutations were failed in the 130 bp samples when compared to the 170 bp samples. Visual inspection of the discarded mutation sites exposed low coverages at the sites embedded in high amplitudes of coverage depth in the affected region. Conclusions: Producing longer insert reads could be a good strategy to achieve better uniform read coverage in coding regions and hereby enhancing the effective sequencing yield to provide an improved basis for further variant calling and CNV analyses.
2016-07-28 | E-MTAB-4527 | biostudies-arrayexpress
Project description:Baiting out a full length sequence from unmapped RNA-seq data
| PRJNA723548 | ENA
Project description:This track is produced as part of the ENCODE Project. It shows high throughput sequencing of RNA samples from tissues or sub cellular compartments from cell lines included in the ENCODE Transcriptome subproject. For data usage terms and conditions, please refer to http://www.genome.gov/27528022 and http://www.genome.gov/Pages/Research/ENCODE/ENCODEDataReleasePolicyFinal2008.pdf The RNA-Seq data were generated from high quality polyA RNA, and the RNA-Seq libraries were constructed using SOLiD Whole Transcriptome (WT) protocol and reagent kit. Total RNA in good quality was used as starting materials and purified twice through MACs polyT column aimed to enrich polyA and remove any contaminants (e.g., rRNA, tRNA, DNA, protein etc.). A one microgram enriched polyA RNA sample was then fragmented to small pieces, and a gel-based selection method was performed to collect fragmented random polyA at a size-range of 50-150 nt in length. The collected fragmental RNA was then hybridized and ligated to a mix of adapters provided from ABI, followed by reverse transcription to generate corresponding cDNAs. The resulting cDNA library was further amplified by PCR and sequenced by SOLiD platform for single reads at 35 bp length (new version in 50 bp length). Cells were grown according to the approved ENCODE cell culture protocols. Data: The SOLiD-generated RNA-Seq reads were 35 bp in length. An initial filtering process was performed to remove any non-desirable contamination sequences, such as rRNA, tRNA, and repeats etc. A read-split mapping approach was developed to map the 35 bp reads onto the reference genome (GRCh37/hg19) excluding mitochondrion, haplotypes, randoms and chromosome Y. Mapping parameters: Strand specific mapping was done using Applied Biosystems' SOLiD alignment where all the reads were mapped to the genome, and to exon-exon junction database. Seed and extend strategy is adopted where initial seed length of 25 is mapped with maximum of 2 mismatches and then extended to read length, each color space match is awarded a score of +1 and each mismatch is awarded a penalty of -2. After extension each read is trimmed to its maximum score, shortest length. The color space sequences are then converted into base space and checked to ensure that each sequence has a maximum of 2 base pair mismatches. If any sequence has more than 2 mismatches, then that sequence is discarded.
2011-02-14 | E-GEOD-27221 | biostudies-arrayexpress
Project description:Purpose: Next-generation sequencing (NGS) has revolutionized systems-based analysis of cellular pathways. The goals of this study are to compare NGS-derived retinal transcriptome profiling (RNA-seq) to microarray and quantitative reverse transcription polymerase chain reaction (qRT–PCR) methods and to evaluate protocols for optimal high-throughput data analysis Methods: RNA from 14-day-old seedlings of wild-type and pkl was isolated using the RNAprep Pure Plant Kit as described above. RNAs from three biological replicates was sequenced separately at Novogene, using Illumina Hiseq X-Ten (Sequencing method: Hiseq-PE150). Results: Reads were mapped to the TAIR10 Arabidopsis genome using TopHat (Galaxy V2.1.1 in usegalaxy.org) with default settings, except that a minimum intron length of 20 bp and a maximum intron length of 5,000 bp were required (Paired-end). Then, mapped reads were assembled according to TAIR10 version of genome annotation using cufflinks (version 2.1.1) with default settings. To analyze differential expression, the assembled transcripts from three independent biological replicates in Col and other mutants were included and compared using Cuffdiff (version 2.1.1) with default settings. 14-day-old seedling of WT and pkl were performed RNA-seq to analyzed their differential expression genes in Arabidopsis.
2022-12-12 | GSE186152 | GEO
Project description:The selected gRNA sequence is tggcatgtttattgagcgctTGG. To disrupt the demethylation motif RRACT in 2288-2290 of Foxo1 mRNA (NM_019739), a mutation (ttGGACT to ctCGATT) target vector was constructed with 1214bp 5’arm and 849bp 3’arm. Mouse zygotes obtained by mating of males with superovulated C57BL/6J females, were injected with a mixture of Cas9 mRNA (80 ng/μl), sgRNA (40 ng/ul) and Donor vector (8 ng/ul). Microinjections were performed into the male pronucleus of fertilized oocytes. Injected zygotes were transferred into pseudopregnant CD1 female mice, and viable adult mice were obtained. Mice were genotyped using sequencing and PCR. PCR primers: mut-F1, ATCCCCATTGAGCAGTAAGTTTTCCA; mut-R1, TGATGGACTCCATGTCACAATCGAG; mut-F2, GCATGTTTATTGAGCGCCTCGAT; mut-R2, CCGCTGTTGCCAAGTCTGAGG; wt-R1, TGATGGACTCCATGTCACAGTCCAA. PCR genotyping of wild-type (wt) and mutant (mut) mice was using primers mut-F1 and mut-R1 to generate fragments of 1291 bp for mut allele, using primers mut-F2 and mut-R2 to generate fragments of 930 bp for mut allele, and using primers mut-F1 and wt-R1 to generate fragments of 1291 bp for wt allele. Total RNA was isolated from Liver Tissue using the TRIzol (Invitrogen) reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol.The libraries were sequenced using HiSeq3000 (Illumina) in paired-read mode, creating reads with a length of 101 bp. Sequencing chemistry v2 (Illumina) was used.
2022-01-26 | GSE125786 | GEO